UBE2E1 (NM_182666) Human Untagged Clone
CAT#: SC307478
UBE2E1 (untagged)-Human ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 2
"NM_182666" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UBE2E1 |
Synonyms | UBCH6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_182666, the custom clone sequence may differ by one or more nucleotides
ATGTCGGATGACGATTCGAGGGCCAGCACCAGCTCCTCCTCATCTTCGTCTTCCAACCAGCAAACCGAGA AAGAAACAAACACCCCCAAGAAGAAGGAGAGTAAAGTCAGCATGAGCAAAAACTCCAAACTCCTCTCCAC CAGCGCCAAGAGTGCTGGTCCCAAAGGCGATAACATCTATGAATGGAGATCAACCATTCTAGGGCCTCCA GGATCCGTGTATGAGGGTGGTGTATTCTTTCTCGATATCACTTTTACACCAGAATATCCCTTCAAGCCTC CAAAGGTTACATTTCGGACAAGAATCTATCATTGTAATATTAACAGTCAAGGTGTTATTTGCTTGGACAT ATTGAAAGATAATTGGAGTCCAGCACTAACCATTTCTAAAGTCCTCCTTTCTATCTGCTCACTTCTTACA GACTGTAATCCTGCCGACCCCTTGGTGGGAAGTATTGCCACTCAGTATATGACCAACAGAGCAGAACATG ACAGAATGGCCAGACAGTGGACCAAGAGATACGCTACATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_182666 |
ORF Size | 531 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_182666.2, NP_872607.1 |
RefSeq Size | 1794 |
RefSeq ORF | 531 |
Locus ID | 7324 |
Protein Pathways | Ubiquitin mediated proteolysis |
Gene Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) lacks an in-frame exon and thus encodes a shorter isoform (2), as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214934 | UBE2E1 (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 2 |
USD 98.00 |
|
RG214934 | UBE2E1 (GFP-tagged) - Human ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 2 |
USD 460.00 |
|
RC214934L3 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC214934L4 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review