Claudin 10 (CLDN10) (NM_182848) Human Untagged Clone

CAT#: SC307522

CLDN10 (untagged)-Human claudin 10 (CLDN10), transcript variant a

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLDN10
• Synonyms: CPETRL3; HELIX; OSP-L; OSPL
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_182848, the custom clone sequence may differ by one or more nucleotides
  ATGTCCAGGGCGCAGATCTGGGCTCTGGTGTCTGGTGTCGGAGGGTTTGGAGCTCTCGTT
  GCTGCTACCACGTCCAATGAGTGGAAAGTGACCACGCGAGCCTCCTCGGTGATAACAGCC
  ACTTGGGTTTACCAGGGTCTGTGGATGAACTGCGCAGGTAACGCGTTGGGTTCTTTCCAT
  TGCCGACCGCATTTTACTATCTTCAAAGTAGCAGGTTATATACAGGCATGTAGAGGACTT
  ATGATCGCTGCTGTCAGCCTGGGCTTCTTTGGTTCCATATTTGCGCTCTTTGGAATGAAG
  TGTACCAAAGTCGGAGGCTCCGATAAAGCCAAAGCTAAAATTGCTTGTTTGGCTGGGATT
  GTATTCATACTGTCAGGGCTGTGCTCAATGACTGGATGTTCCCTATATGCAAACAAAATC
  ACAACGGAATTCTTTGATCCTCTCTTTGTTGAGCAAAAGTATGAATTAGGAGCCGCTCTG
  TTTATTGGATGGGCAGGAGCCTCACTGTGCATAATTGGTGGTGTCATATTTTGCTTTTCA
  ATATCTGACAACAACAAAACACCCAGATACACATACAACGGGGCCACATCTGTCATGTCT
  TCTCGGACAAAGTATCATGGTGGAGAAGATTTTAAAACAACAAACCCTTCAAAACAGTTT
  GATAAAAATGCTTATGTCTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_182848
• ORF Size: 681 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_182848.2, NP_878268.1
• RefSeq Size: 2549
• RefSeq ORF: 681
• Locus ID: 9071
• Protein Families: Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The expression level of this gene is associated with recurrence of primary hepatocellular carcinoma. Six alternatively spliced transcript variants encoding different isoforms have been reported, but the transcript sequences of some variants are not determined. [provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (a) represents the longest transcript and encodes isoform a.