CCNB1IP1 (NM_182852) Human Untagged Clone

CAT#: SC307525

CCNB1IP1 (untagged)-Human cyclin B1 interacting protein 1, E3 ubiquitin protein ligase (CCNB1IP1), transcript variant 4


  "NM_182852" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CCNB1IP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCNB1IP1
Synonyms C14orf18; HEI10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_182852, the custom clone sequence may differ by one or more nucleotides


ATGTCTTTGTGTGAAGACATGCTGCTTTGTAATTATCGAAAGTGTCGCATCAAACTCTCTGGCTATGCAT
GGGTCACTGCCTGCTCTCACATCTTCTGTGATCAGCATGGCAGTGGTGAGTTTAGTCGCTCACCAGCTAT
CTGTCCTGCCTGCAACAGTACCCTTTCTGGAAAGCTAGATATTGTCCGCACAGAACTCAGTCCATCAGAG
GAATATAAAGCTATGGTATTGGCAGGACTGCGACCAGAGATCGTGTTGGACATTAGCTCCCGAGCGCTGG
CCTTCTGGACATATCAGGTACATCAGGAACGTCTCTATCAAGAATACAATTTCAGCAAGGCTGAGGGCCA
TCTGAAACAGATGGAGAAGATATATACTCAGCAAATACAAAGCAAGGATGTAGAATTGACCTCTATGAAA
GGGGAGGTTACCTCCATGAAGAAAGTACTAGAAGAATACAAGAAAAAGTTCAGTGACATCTCTGAGAAAC
TTATGGAGCGCAATCGTCAGTATCAAAAGCTCCAAGGCCTCTATGATAGCCTTAGGCTACGAAACATCAC
TATTGCTAACCATGAAGGCACCCTTGAACCATCCATGATTGCACAGTCTGGTGTTCTTGGCTTCCCATTA
GGTAACAACTCCAAGTTTCCTTTGGATAATACACCTGTTCGAAATCGGGGCGATGGAGATGGAGATTTTC
AGTTCAGACCATTTTTTGCGGGTTCTCCCACAGCACCTGAACCCAGCAACAGCTTTTTTAGTTTTGTCTC
TCCAAGTCGTGAATTAGAGCAGCAGCAAGTTTCTAGCAGGGCCTTCAAAGTAAAAAGAATTTGA


Restriction Sites SgfI-MluI     
ACCN NM_182852
ORF Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_182852.3, NP_878272.1
RefSeq Size 1686
RefSeq ORF 834
Locus ID 57820
Gene Summary HEI10 is a member of the E3 ubiquitin ligase family and functions in progression of the cell cycle through G(2)/M. [supplied by OMIM, Apr 2004]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. All variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.