IKZF3 (NM_183231) Human Untagged Clone
CAT#: SC307560
IKZF3 (untagged)-Human IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 5
"NM_183231" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IKZF3 |
Synonyms | AIO; AIOLOS; ZNFN1A3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_183231, the custom clone sequence may differ by one or more nucleotides
ATGGAAGATATACAAACAAATGCGGAACTGAAAAGCACTCAGGAGCAGTCTGTGCCCGCAGAAAGTGCAG CGGTTTTGAATGACTACAGTTTAACCAAATCTCATGAAATGGAAAATGTGGACAGTGGAGAAGGCCCAGC CAATGAAGATGAAGACATAGGAGATGATTCAATGAAAGTGAAAGATGAATACAGTGAAAGAGATGAGAAT GTTTTAAAGTCAGAACCCATGGGAAATGCAGAAGAGCCTGAAATCCCTTACAGCTATTCAAGAGAATATA ATGAATATGAAAACATTAAGTTGGAGAGACATGTTGTCTCATTCGATAGTAGCAGGCCAACCAGTGGAAA GATGAACTGCGATGTGTGTGGATTATCCTGCATCAGCTTCAATGTCTTAATGGTTCATAAGCGAAGCCAT ACTGCAAGTGCGGAGGCAAGACACATCAAAGCAGAGATGGGAAGTGAAAGAGCTCTCGTACTGGACAGAT TAGCAAGCAATGTGGCAAAACGAAAAAGCTCAATGCCTCAGAAATTCATTGGTGAGAAGCGCCACTGCTT TGATGTCAACTATAATTCAAGTTACATGTATGAGAAAGAGAGTGAGCTCATACAGACCCGCATGATGGAC CAAGCCATCAATAACGCCATCAGCTATCTTGGCGCCGAAGCCCTGCGCCCCTTGGTCCAGACACCGCCTG CTCCCACCTCGGAGATGGTTCCAGTTATCAGCAGCATGTATCCCATAGCCCTCACCCGGGCTGAGATGTC AAACGGTGCCCCTCAAGAGCTGGAAAAGAAAAGCATCCACCTTCCAGAGAAGAGCGTGCCTTCTGAGAGA GGCCTCTCTCCCAACAATAGTGGCCACGACTCCACGGACACTGACAGCAACCATGAAGAACGCCAGAATC ACATCTATCAGCAAAATCACATGGTCCTGTCTCGGGCCCGCAATGGGATGCCACTTCTGAAGGAGGTTCC CCGCTCTTACGAACTCCTCAAGCCCCCGCCCATCTGCCCAAGAGACTCCGTCAAAGTGATCAACAAGGAA GGGGAGGTGATGGATGTGTATCGGTGTGACCACTGCCGCGTCCTCTTCCTGGACTATGTGATGTTCACGA TTCACATGGGCTGCCACGGCTTCCGTGACCCTTTCGAGTGTAACATGTGTGGATATCGAAGCCATGATCG GTATGAGTTCTCGTCTCACATAGCCAGAGGAGAACACAGAGCCCTGCTGAAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_183231 |
ORF Size | 1245 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_183231.2, NP_899054.1 |
RefSeq Size | 9401 |
RefSeq ORF | 1245 |
Locus ID | 22806 |
Gene Summary | This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (5) lacks two alternate in-frame exons compared to variant 1. The resulting isoform (5, also known as Aio-del4,5) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219750 | IKZF3 (Myc-DDK-tagged)-Human IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 5 |
USD 420.00 |
|
RG219750 | IKZF3 (GFP-tagged) - Human IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 5 |
USD 460.00 |
|
RC219750L3 | Lenti-ORF clone of IKZF3 (Myc-DDK-tagged)-Human IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 5 |
USD 620.00 |
|
RC219750L4 | Lenti-ORF clone of IKZF3 (mGFP-tagged)-Human IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 5 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review