ROC2 (RNF7) (NM_183237) Human Untagged Clone

CAT#: SC307562

RNF7 (untagged)-Human ring finger protein 7 (RNF7), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RNF7
• Synonyms: CKBBP1; rbx2; ROC2; SAG
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_183237, the custom clone sequence may differ by one or more nucleotides
  ATGGCCGACGTGGAAGACGGAGAGGAAACCTGCGCCCTGGCCTCTCACTCCGGGAGCTCA
  GGCTCCAAGTCGGGAGGCGACAAGATGTTCTCCCTCAAGAAGTGGAACGCGGTGGCCATG
  TGGAGCTGGGACGTGGAGTGCGATACGTGCGCCATCTGCAGGGTCCAGATGCCTGTCTTA
  GATGTCAAGCTGAAAACAAACAAGAGGACTGTGTTGTGGTCTGGGGAGAATGTAATCATT
  CCTTCCACAACTGCTGCATGTCCCTGTGGGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_183237
• ORF Size: 273 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_183237.1, NP_899060.1
• RefSeq Size: 1609
• RefSeq ORF: 273
• Locus ID: 9616
• Protein Families: Druggable Genome
• Protein Pathways: Ubiquitin mediated proteolysis
• Gene Summary: The protein encoded by this gene is a highly conserved ring finger protein. It is an essential subunit of SKP1-cullin/CDC53-F box protein ubiquitin ligases, which are a part of the protein degradation machinery important for cell cycle progression and signal transduction. This protein interacts with, and is a substrate of, casein kinase II (CSNK2A1/CKII). The phosphorylation of this protein by CSNK2A1 has been shown to promote the degradation of IkappaBalpha (CHUK/IKK-alpha/IKBKA) and p27Kip1(CDKN1B). Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) uses an alternate splice site in the coding region compared to variant 1, which causes a frameshift. The resulting shorter isoform (3) has a distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.