ROC2 (RNF7) (NM_183237) Human Untagged Clone

CAT#: SC307562

RNF7 (untagged)-Human ring finger protein 7 (RNF7), transcript variant 3


  "NM_183237" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "RNF7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RNF7
Synonyms CKBBP1; rbx2; ROC2; SAG
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_183237, the custom clone sequence may differ by one or more nucleotides
ATGGCCGACGTGGAAGACGGAGAGGAAACCTGCGCCCTGGCCTCTCACTCCGGGAGCTCA
GGCTCCAAGTCGGGAGGCGACAAGATGTTCTCCCTCAAGAAGTGGAACGCGGTGGCCATG
TGGAGCTGGGACGTGGAGTGCGATACGTGCGCCATCTGCAGGGTCCAGATGCCTGTCTTA
GATGTCAAGCTGAAAACAAACAAGAGGACTGTGTTGTGGTCTGGGGAGAATGTAATCATT
CCTTCCACAACTGCTGCATGTCCCTGTGGGTGA
Restriction Sites Please inquire     
ACCN NM_183237
ORF Size 273 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_183237.1, NP_899060.1
RefSeq Size 1609
RefSeq ORF 273
Locus ID 9616
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary The protein encoded by this gene is a highly conserved ring finger protein. It is an essential subunit of SKP1-cullin/CDC53-F box protein ubiquitin ligases, which are a part of the protein degradation machinery important for cell cycle progression and signal transduction. This protein interacts with, and is a substrate of, casein kinase II (CSNK2A1/CKII). The phosphorylation of this protein by CSNK2A1 has been shown to promote the degradation of IkappaBalpha (CHUK/IKK-alpha/IKBKA) and p27Kip1(CDKN1B). Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) uses an alternate splice site in the coding region compared to variant 1, which causes a frameshift. The resulting shorter isoform (3) has a distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.