ACCN1 (ASIC2) (NM_183377) Human Untagged Clone

CAT#: SC307569

ASIC2 (untagged)-Human amiloride-sensitive cation channel 1, neuronal (ACCN1), transcript variant 1


  "NM_183377" in other vectors (6)

Reconstitution Protocol

USD 960.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ASIC2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ASIC2
Synonyms ACCN; ACCN1; ASIC2a; BNaC1; BNC1; hBNaC1; MDEG
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_183377, the custom clone sequence may differ by one or more nucleotides


ATGAGCCGGATTGGCGGAGCCGGGCTGCCCGCAGCCGCGCTCACCGGCCCGGGACGCTTCCGCATGGCCC
GCGAGGAGCCGGCGCCCGCGGCGTTGGCGGCTGCCGGGCAGCCCGGGGGCGGCAGAGGCGGCGAGCGGGC
GCTGCAGGGGCCAGGGGTCGCCCGCAGGGGGCGGCCATCGCTGAGCCGCGCTAAACTGCACGGGCTGCGG
CACATGTGTGCCGGGCGCACGGCGGCTGGGGGCTCCTTCCAGCGGCGGGCGCTGTGGGTGCTGGCCTTCT
GTACATCCTTCGGCTTGCTGCTGTCCTGGTCCTCGAACCGCTTGCTCTACTGGCTCAGCTTCCCGTCACA
CACGCGGGTGCACCGCGAGTGGAGCCGCCAGTTACCCTTCCCCGCCGTCACTGTGTGCAACAACAACCCG
CTGCGCTTCCCGCGCCTCTCCAAGGGGGACCTCTACTATGCCGGCCACTGGCTCGGGCTGCTGCTGCCCA
ACCGCACCGCGCGCCCGCTTGTCAGCGAGCTGCTGCGGGGCGACGAGCCGCGCCGCCAGTGGTTCCGCAA
GCTGGCGGACTTCCGCCTCTTCCTGCCTCCGCGCCACTTCGAGGGAATCAGCGCCGCCTTCATGGACCGC
CTGGGCCACCAGCTGGAGGACATGCTGCTCTCCTGCAAGTACCGCGGCGAGCTCTGCGGGCCGCACAACT
TCTCCTCCGTGTTTACAAAATATGGGAAGTGTTACATGTTTAACTCAGGCGAGGATGGCAAACCTCTGCT
CACCACGGTCAAGGGGGGGACAGGCAACGGGCTGGAGATCATGCTGGACATTCAGCAGGATGAGTACCTG
CCCATCTGGGGAGAGACAGAGGAAACGACATTTGAAGCAGGAGTGAAAGTTCAGATCCACAGTCAGTCTG
AGCCACCTTTCATCCAAGAGCTGGGCTTTGGGGTGGCTCCAGGGTTCCAGACCTTTGTGGCCACACAGGA
GCAGAGGCTCACATACCTGCCCCCACCGTGGGGTGAGTGCCGATCCTCAGAGATGGGCCTCGACTTTTTT
CCTGTTTACAGCATCACCGCCTGTAGGATTGACTGTGAGACCCGCTACATTGTGGAAAACTGCAACTGCC
GCATGGTTCACATGCCAGGGGATGCCCCTTTTTGTACCCCTGAGCAGCACAAGGAGTGTGCAGAGCCTGC
CCTAGGTCTGTTGGCGGAAAAGGACAGCAATTACTGTCTCTGCAGGACACCCTGCAACCTAACCCGCTAC
AACAAAGAGCTCTCCATGGTGAAGATCCCCAGCAAGACATCAGCCAAGTACCTTGAGAAGAAATTTAACA
AATCAGAAAAATATATCTCAGAGAACATCCTTGTTCTGGATATATTTTTTGAAGCTCTCAATTATGAGAC
AATTGAACAGAAGAAGGCGTATGAAGTTGCTGCCTTACTTGGTGATATTGGTGGTCAGATGGGATTGTTC
ATTGGTGCTAGTATCCTTACAATACTAGAGCTCTTTGATTATATTTATGAGCTGATCAAAGAGAAGCTAT
TAGACCTGCTTGGCAAAGAGGAGGACGAAGGGAGCCACGATGAGAATGTGAGTACTTGTGACACAATGCC
AAACCACTCTGAAACCATCAGTCACACTGTGAACGTGCCCCTGCAGACGACCCTGGGGACCTTGGAGGAG
ATTGCCTGCTGA


Restriction Sites Please inquire     
ACCN NM_183377
Insert Size 2600 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation A TrueClone.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_183377.1, NP_899233.1
RefSeq Size 3470 bp
RefSeq ORF 1692 bp
Locus ID 40
Cytogenetics 17q11.2-q12
Protein Families Druggable Genome, Ion Channels: Other
Protein Pathways Taste transduction
Gene Summary 'This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene may play a role in neurotransmission. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 3 has been observed to co-assemble into proton-gated channels sensitive to gadolinium. Alternative splicing has been observed at this locus and two variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Feb 2012]'
Transcript Variant: This variant (MDEG2) represents the longer transcript and encodes the longer isoform (MDEG2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.