CLECSF6 (CLEC4A) (NM_194448) Human Untagged Clone
CAT#: SC307605
CLEC4A (untagged)-Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 4
"NM_194448" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CLEC4A |
Synonyms | CD367; CLECSF6; DCIR; DDB27; HDCGC13P; LLIR |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_194448, the custom clone sequence may differ by one or more nucleotides
ATGACTTCGGAAATCACTTATGCTGAAGTGAGGTTCAAAAATGAATTCAAGTCCTCAGGCATCAACACAG CCTCTTCTGCAGAGACAGCCTGGAGCTGTTGCCCAAAGAATTGGAAGTCATTTAGTTCCAACTGCTACTT TATTTCTACTGAATCAGCATCTTGGCAAGACAGTGAGAAGGACTGTGCTAGAATGGAGGCTCACCTGCTG GTGATAAACACTCAAGAAGAGCAGGATTTCATCTTCCAGAATCTGCAAGAAGAATCTGCTTATTTTGTGG GGCTCTCAGATCCAGAAGGTCAGCGACATTGGCAATGGGTTGATCAGACACCATACAATGAAAGTTCCAC ATTCTGGCATCCACGTGAGCCCAGTGATCCCAATGAGCGCTGCGTTGTGCTAAATTTTCGTAAATCACCC AAAAGATGGGGCTGGAATGATGTTAATTGTCTTGGTCCTCAAAGGTCAGTTTGTGAGATGATGAAGATCC ACTTATGA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | Please inquire |
ACCN | NM_194448 |
ORF Size | 498 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_194448.1, NP_919430.1 |
RefSeq Size | 1075 |
RefSeq ORF | 498 |
Locus ID | 50856 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in inflammatory and immune response. Multiple transcript variants encoding distinct isoforms have been identified for this gene. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4), also known as LLIRv2, lacks an in-frame segment of the coding region, compared to variant 1. It encodes the shortest isoform (4), that is missing a region thought to be responsible for oligomerization, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214844 | CLEC4A (Myc-DDK-tagged)-Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 4 |
USD 98.00 |
|
RG214844 | CLEC4A (GFP-tagged) - Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 4 |
USD 460.00 |
|
RC214844L1 | Lenti ORF clone of Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC214844L2 | Lenti ORF clone of Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 4, mGFP tagged |
USD 620.00 |
|
RC214844L3 | Lenti ORF clone of Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC214844L4 | Lenti ORF clone of Human C-type lectin domain family 4, member A (CLEC4A), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review