MITF (NM_198178) Human Untagged Clone

CAT#: SC307640

MITF (untagged)-Human microphthalmia-associated transcription factor (MITF), transcript variant 6


  "NM_198178" in other vectors (6)

Reconstitution Protocol

USD 610.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MITF"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MITF
Synonyms bHLHe32; CMM8; COMMAD; MI; WS2; WS2A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_198178 edited
AAACATTGTTATGCTGGAAATGCTAGAATATAATCACTATCAGGTGCAGACCCACCTCGA
AAACCCCACCAAGTACCACATACAGCAAGCCCAACGGCAGCAGGTAAAGCAGTACCTTTC
TACCACTTTAGCAAATAAACATGCCAACCAAGTCCTGAGCTTGCCATGTCCAAACCAGCC
TGGCGATCATGTCATGCCACCGGTGCCGGGGAGCAGCGCACCCAACAGCCCCATGGCTAT
GCTTACGCTTAACTCCAACTGTGAAAAAGAGGGATTTTATAAGTTTGAAGAGCAAAACAG
GGCAGAGAGCGAGTGCCCAGGCATGAACACACATTCACGAGCGTCCTGTATGCAGATGGA
TGATGTAATCGATGACATCATTAGCCTAGAATCAAGTTATAATGAGGAAATCTTGGGCTT
GATGGATCCTGCTTTGCAAATGGCAAATACGTTGCCTGTCTCGGGAAACTTGATTGATCT
TTATGGAAACCAAGGTCTGCCCCCACCAGGCCTCACCATCAGCAACTCCTGTCCAGCCAA
CCTTCCCAACATAAAAAGGGAGCTCACAGAGTCTGAAGCAAGAGCACTGGCCAAAGAGAG
GCAGAAAAAGGACAATCACAACCTGATTGAACGAAGAAGAAGATTTAACATAAATGACCG
CATTAAAGAACTAGGTACTTTGATTCCCAAGTCAAATGATCCAGACATGCGCTGGAACAA
GGGAACCATCTTAAAAGCATCCGTGGACTATATCCGAAAGTTGCAACGAGAACAGCAACG
CGCAAAAGAACTTGAAAACCGACAGAAGAAACTGGAGCACGCCAACCGGCATTTGTTGCT
CAGAATACAGGAACTTGAAATGCAGGCTCGAGCTCATGGACTTTCCCTTATTCCATCCAC
GGGTCTCTGCTCTCCAGATTTGGTGAATCGGATCATCAAGCAAGAACCCGTTCTTGAGAA
CTGCAGCCAAGACCTCCTTCAGCATCATGCAGACCTAACCTGTACAACAACTCTCGATCT
CACGGATGGCACCATCACCTTCAACAACAACCTCGGAACTGGGACTGAGGCCAACCAAGC
CTATAGTGTCCCCACAAAAATGGGATCCAAACTGGAAGACATCCTGATGGACGACACCCT
TTCTCCCGTCGGTGTCACTGATCCACTCCTTTCCTCAGTGTCCCCCGGAGCTTCCAAAAC
AAGCAGCCGGAGGAGCAGTATGAGCATGGAAGAGACGGAGCACACTTGTTAGCGAATCCT
CCCTGCACTGCATTCGCACAAACTGCTTCCTTTCTTGATT
Restriction Sites Please inquire     
ACCN NM_198178
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_198178.1, NP_937821.1
RefSeq Size 4597 bp
RefSeq ORF 1488 bp
Locus ID 4286
Cytogenetics 3p13
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Melanogenesis, Melanoma, Pathways in cancer
Gene Summary 'The protein encoded by this gene is a transcription factor that contains both basic helix-loop-helix and leucine zipper structural features. The encoded protein regulates melanocyte development and is responsible for pigment cell-specific transcription of the melanogenesis enzyme genes. Heterozygous mutations in the this gene cause auditory-pigmentary syndromes, such as Waardenburg syndrome type 2 and Tietz syndrome. [provided by RefSeq, Aug 2017]'
Transcript Variant: This variant (6) differs in the 5' UTR and the 5' coding region, and uses two alternate, in-frame splice sites in the coding region compared to variant 1. The resulting isoform (6), also known as isoform MITF-Mdel, has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.