ING3 (NM_198267) Human Untagged Clone

CAT#: SC307660

ING3 (untagged)-Human inhibitor of growth family, member 3 (ING3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ING3
• Synonyms: Eaf4; ING2; MEAF4; p47ING3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_198267, the custom clone sequence may differ by one or more nucleotides
  ATGTTGTACCTAGAAGACTATCTGGAAATGATTGAGCAGCTTCCTATGGATCTGCGGGAC
  CGCTTCACGGAAATGCGCGAGATGGACCTGCAGGTGCAGAATGCAATGGATCAACTAGAA
  CAAAGAGTCAGTGAATTCTTTATGAATGCAAAGAAAAATAAACCTGAGTGGAGGGAAGAG
  CAAATGGCATCCATCAAAAAAGACTACTATAAAGCTTTGGAAGATGCAGATGAGAAGGTT
  CAGTTGGCAAACCAGATATATGACTTGCAGCACTTCTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_198267
• ORF Size: 279 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_198267.1, NP_938008.1
• RefSeq Size: 1240
• RefSeq ORF: 279
• Locus ID: 54556
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) uses a different segment in its 3' coding region and UTR, compared to variant 1, with a resulting frameshift. The predicted isoform (3) has a distinct and shorter C-terminus, as compared to isoform 1. This transcript is supported by several ESTs, but the predicted ORF has not yet been experimentally confirmed.