HSD11B1L (NM_198705) Human Untagged Clone
CAT#: SC307780
HSD11B1L (untagged)-Human hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant a
"NM_198705" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HSD11B1L |
Synonyms | 11-beta-HSD3; 11-DH3; HSD1L; HSD3; SCDR10; SCDR10B; SDR26C2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_198705, the custom clone sequence may differ by one or more nucleotides
ATGAAGGTGCTTCTCCTCACAGGGCTGGGGGCCCTGTTCTTCGCCTATTATTGGGATGAC AACTTCGACCCAGGCGGGCTGGACTACCTCGTGCTGAACCACATCGGCGGCGCCCCGGCC GGCACGCGAGCCCGCAGCCCCCAGGCAACTCGCTGGCTCATGCAGGTAAACTTTGTGAGC TACGTGCAACTGACGTCGCGGGCGCTGCCCAGCCTGACGGACAGCAAGGGCTCCCTGGTG GTGGTGTCCTCGCTGCTCGGCCGCGTGCCCACGTCGTTCTCCACTCCCTACTCGGCGGCC AAGTTTGCGCTGGACGGCTTCTTCGGCTCCCTGCGGCGGGAGCTGGACGTGCAGGACGTG AACGTGGCCATCACCATGTGCGTCCTGGGCCTCCGAGATCGCGCCTCCGCCGCCGAGGCA GTCAGGGGAGTCACGAGGGTCAAGGCGGCCCCGGGGCCCAAGGCAGCCCTGGCCGTGATC CGCGGCGGCGCCACGCGCGCGGCCGGCGTCTTCTACCCGTGGCGTTTCCGCCTGCTGTGC TTGCTCCGGCGCTGGCTACCGCGCCCGCGGGCCTGGTTTATCCGCCAGGAGCTCAACGTC ACGGCCGCGGCAGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_198705 |
ORF Size | 618 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_198705.1, NP_941994.1 |
RefSeq Size | 1474 |
RefSeq ORF | 618 |
Locus ID | 374875 |
Protein Families | Druggable Genome |
Gene Summary | This gene is a member of the hydroxysteroid dehydrogenase family. The encoded protein is similar to an enzyme that catalyzes the interconversion of inactive to active glucocorticoids (e.g. cortisone). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (a) has multiple differences in the coding region, one of which results in initiation of translation at a downstream in-frame start codon, compared to variant g. The encoded protein (isoform a) is shorter than isoform g. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222977 | HSD11B1L (Myc-DDK-tagged)-Human hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant a |
USD 420.00 |
|
RG222977 | HSD11B1L (GFP-tagged) - Human hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant a |
USD 460.00 |
|
RC222977L3 | Lenti-ORF clone of HSD11B1L (Myc-DDK-tagged)-Human hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant a |
USD 620.00 |
|
RC222977L4 | Lenti-ORF clone of HSD11B1L (mGFP-tagged)-Human hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant a |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review