OR7C1 (NM_198944) Human Untagged Clone
CAT#: SC307820
OR7C1 (untagged)-Human olfactory receptor, family 7, subfamily C, member 1 (OR7C1)
"NM_198944" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | OR7C1 |
Synonyms | CIT-HSP-146E8; HSTPCR86P; OR7C4; OR19-5; TPCR86 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_198944, the custom clone sequence may differ by one or more nucleotides
ATGGAAACAGGAAATCAAACACATGCCCAAGAATTTCTCCTCCTGGGATTTTCAGCAACGTCAGAGATTC AGTTCATTCTCTTTGGGCTGTTCCTCTCCATGTACCTAGTCACTTTCACCGGGAACCTGCTCATCATCCT GGCCATATGCTCAGACTCCCACCTCCACACCCCCATGTACTTCTTCCTCTCCAACCTGTCTTTTGCTGAC CTCTGTTTTACCTCCACGACTGTCCCAAAGATGTTACTGAATATACTGACACAGAACAAATTCATAACAT ATGCAGGCTGTCTCAGTCAGATTTTTTTTTTCACTTCATTTGGATGCCTGGACAATTTACTCTTGACCGT GATGGCCTATGACCGCTTCGTGGCCGTCTGTCACCCCCTGCACTATACGGTCATCATGAACCCCCAGCTC TGTGGACTGCTGGTTCTGGGGTCCTGGTGCATCAGTGTCATGGGTTCCCTGCTCGAGACCTTGACTGTTT TGAGGCTGTCCTTCTGCACCGAAATGGAAATTCCACACTTTTTTTGTGATCTACTTGAAGTCCTGAAGCT CGCCTGTTCTGACACCTTCATTAATAACGTGGTGATATACTTTGCAACTGGCGTCCTGGGTGTGATTTCC TTCACTGGAATATTTTTCTCTTACTATAAAATTGTTTTCTCTATACTGAGGATTTCCTCAGCTGGGAGAA AGCACAAAGCGTTTTCCACCTGTGGTTCCCACCTCTCAGTGGTCACCTTGTTCTATGGCACGGGCTTTGG GGTCTATCTCAGTTCTGCAGCCACACCATCTTCTAGGACAAGTCTGGTGGCCTCAGTGATGTACACCATG GTCACCCCCATGCTGAACCCCTTCATCTACAGCCTGAGGAACACGGACATGAAGAGGGCCCTGGGGAGAC TCCTCAGTAGGGCAACATTTTTTAATGGTGACATCACTGCAGGACTTTCATAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_198944 |
ORF Size | 963 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_198944.1, NP_945182.1 |
RefSeq Size | 963 |
RefSeq ORF | 963 |
Locus ID | 26664 |
Protein Families | Transmembrane |
Protein Pathways | Olfactory transduction |
Gene Summary | Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216280 | OR7C1 (Myc-DDK-tagged)-Human olfactory receptor, family 7, subfamily C, member 1 (OR7C1) |
USD 420.00 |
|
RG216280 | OR7C1 (GFP-tagged) - Human olfactory receptor, family 7, subfamily C, member 1 (OR7C1) |
USD 460.00 |
|
RC216280L3 | Lenti ORF clone of Human olfactory receptor, family 7, subfamily C, member 1 (OR7C1), Myc-DDK-tagged |
USD 620.00 |
|
RC216280L4 | Lenti ORF clone of Human olfactory receptor, family 7, subfamily C, member 1 (OR7C1), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review