THAP1 (NM_199003) Human Untagged Clone

CAT#: SC307848

THAP1 (untagged)-Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: THAP1
• Synonyms: DYT6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199003, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGCAGTCCTGCTCCGCCTACGGCTGCAAGAACCGCTACGACAAGGACAAGCCCGTTTCTTTCCACA
  AAAAGAAGATCTTCTGGAGCCACAGGAACAGCTTCCCCCACCTCCTTTACCGCCTCCTGTTTCCCAGGTT
  GATGCTGCTATTGGATTACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_199003
• ORF Size: 162 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_199003.1, NP_945354.1
• RefSeq Size: 1993
• RefSeq ORF: 162
• Locus ID: 55145
• Gene Summary: The protein encoded by this gene contains a THAP domain, a conserved DNA-binding domain. This protein colocalizes with the apoptosis response protein PAWR/PAR-4 in promyelocytic leukemia (PML) nuclear bodies, and functions as a proapoptotic factor that links PAWR to PML nuclear bodies. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks a coding exon compared to variant 1, which causes a frameshift. The resulting isoform (2) has a distinct and shorter C-terminus, as compared to isoform 1.