VWA1 (NM_199121) Human Untagged Clone

CAT#: SC307865

VWA1 (untagged)-Human von Willebrand factor A domain containing 1 (VWA1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: VWA1
• Synonyms: WARP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199121, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCCCCTGGACGGCGCTCGGCCTGGCCCTGAGCTTGCGGCTGGCGCTGGCGCGGAGCGGCGCGGAGC
  GCGGAGCTCAAGGACCTGGGCGTCACCGTGTTCATTGTCAGCACCGGCCGAGGCAACTTCCTGGAGCTGT
  CAGCCGCTGCCTCAGCCCCTGCCGAGAAGCACCTGCACTTTGTGGACGTGGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_199121
• ORF Size: 195 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_199121.2, NP_954572.2
• RefSeq Size: 4264
• RefSeq ORF: 195
• Locus ID: 64856
• Gene Summary: VWA1 belongs to the von Willebrand factor (VWF; MIM 613160) A (VWFA) domain superfamily of extracellular matrix proteins and appears to play a role in cartilage structure and function (Fitzgerald et al., 2002 [PubMed 12062410]). [supplied by OMIM, Nov 2010]
  Transcript Variant: This variant (2) uses an alternate splice site that causes a frameshift in the central coding region, compared to variant 1. The encoded isoform (2) has a significantly shorter and distinct C-terminus, compared to isoform 1.