BPGM (NM_199186) Human Untagged Clone

CAT#: SC307893

BPGM (untagged)-Human 2,3-bisphosphoglycerate mutase (BPGM), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BPGM
• Synonyms: DPGM; ECYT8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199186, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCAAGTACAAACTTATTATGTTAAGACATGGAGAGGGTGCTTGGAATAAGGAGAACCGTTTTTGTA
  GCTGGGTGGATCAGAAACTCAACAGCGAAGGAATGGAGGAAGCTCGGAACTGTGGGAAGCAACTCAAAGC
  GTTAAACTTTGAGTTTGATCTTGTATTCACATCTGTCCTTAATCGGTCCATTCACACAGCCTGGCTGATC
  CTGGAAGAGCTAGGCCAGGAATGGGTGCCTGTGGAAAGCTCCTGGCGTCTAAATGAGCGTCACTATGGGG
  CCTTGATCGGTCTCAACAGGGAGCAGATGGCTTTGAATCATGGTGAAGAACAAGTGAGGCTCTGGAGAAG
  AAGCTACAATGTAACCCCGCCTCCCATTGAGGAGTCTCATCCTTACTACCAAGAAATCTACAACGACCGG
  AGGTATAAAGTATGCGATGTGCCCTTGGATCAACTGCCACGGTCGGAAAGCTTAAAGGATGTTCTGGAGA
  GACTCCTTCCCTATTGGAATGAAAGGATTGCTCCCGAAGTATTACGTGGCAAAACCATTCTGATATCTGC
  TCATGGAAATAGCAGTAGGGCACTCCTAAAACACCTGGAAGGTATCTCAGATGAAGACATCATCAACATT
  ACTCTTCCTACTGGAGTCCCCATTCTTCTGGAATTGGATGAAAACCTGCGTGCTGTTGGGCCTCATCAGT
  TCCTGGGTGACCAAGAGGCGATCCAAGCAGCCATTAAGAAAGTAGAAGATCAAGGAAAAGTGAAACAAGC
  TAAAAAATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_199186
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_199186.2, NP_954655.1
• RefSeq Size: 2121 bp
• RefSeq ORF: 780 bp
• Locus ID: 669
• Cytogenetics: 7q33
• Protein Families: Druggable Genome
• Protein Pathways: Glycolysis / Gluconeogenesis, Metabolic pathways
• Gene Summary: '2,3-diphosphoglycerate (2,3-DPG) is a small molecule found at high concentrations in red blood cells where it binds to and decreases the oxygen affinity of hemoglobin. This gene encodes a multifunctional enzyme that catalyzes 2,3-DPG synthesis via its synthetase activity, and 2,3-DPG degradation via its phosphatase activity. The enzyme also has phosphoglycerate phosphomutase activity. Deficiency of this enzyme increases the affinity of cells for oxygen. Mutations in this gene result in hemolytic anemia. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]'
  Transcript Variant: This variant (2) represents the longer transcript. Variants 1, 2, and 3 encode the same protein.