COLEC11 (NM_199235) Human Untagged Clone

CAT#: SC307907

COLEC11 (untagged)-Human collectin sub-family member 11 (COLEC11), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COLEC11
• Synonyms: 3MC2; CL-K1-I; CL-K1-II; CL-K1-IIa; CL-K1-IIb; CLK1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199235, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACGCCTGCTCTGTGCAGATCCTCGTCCCTGGCCTCAAAGGGGATGCGGGAGAGAAGGGAGACAAAGG
  CGCCCCCGGACGGCCTGGAAGAGTCGGCCCCACGGGAGAAAAAGCAGTCACAGCCAGTCGTGACAGCTTC
  TGACATCTCCAAAAGGAAGTGCACCTCGTCCTTTGTAGAAATGGGATCACAGGGAGACATGGGGGACAAA
  GGACAGAAAGGCAGTGTGGGTCGTCATGGAAAAATTGGTCCCATTGGCTCTAAAGGTGAGAAAGGAGATT
  CCGGTGACATAGGACCCCCTGGTCCTAATGGAGAACCAGGCCTCCCATGTGAGTGCAGCCAGCTGCGCAA
  GGCCATCGGGGAGATGGACAACCAGGTCTCTCAGCTGACCAGCGAGCTCAAGTTCATCAAGAATGCTGTC
  GCCGGTGTGCGCGAGACGGAGAGCAAGATCTACCTGCTGGTGAAGGAGGAGAAGCGCTACGCGGACGCCC
  AGCTGTCCTGCCAGGGCCGCGGGGGCACGCTGAGCATGCCCAAGGACGAGGCTGCCAATGGCCTGATGGC
  CGCATACCTGGCGCAAGCCGGCCTGGCCCGTGTCTTCATCGGCATCAACGACCTGGAGAAGGAGGGCGCC
  TTCGTGTACTCTGACCACTCCCCCATGCGGACCTTCAACAAGTGGCGCAGCGGTGAGCCCAACAATGCCT
  ACGACGAGGAGGACTGCGTGGAGATGGTGGCCTCGGGCGGCTGGAACGACGTGGCCTGCCACACCACCAT
  GTACTTCATGTGTGAGTTTGACAAGGAGAACATGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_199235
• ORF Size: 807 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_199235.2, NP_954705.1
• RefSeq Size: 1784
• RefSeq ORF: 807
• Locus ID: 78989
• Gene Summary: This gene encodes a member of the collectin family of C-type lectins that possess collagen-like sequences and carbohydrate recognition domains. Collectins are secreted proteins that play important roles in the innate immune system by binding to carbohydrate antigens on microorganisms, facilitating their recognition and removal. The encoded protein binds to multiple sugars with a preference for fucose and mannose. Mutations in this gene are a cause of 3MC syndrome-2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (2) includes an alternate exon in the 3' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) is shorter and has a distinct N-terminus, compared to isoform a.