COPE (NM_199444) Human Untagged Clone
CAT#: SC307979
COPE (untagged)-Human coatomer protein complex, subunit epsilon (COPE), transcript variant 3
"NM_199444" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | COPE |
Synonyms | epsilon-COP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_199444, the custom clone sequence may differ by one or more nucleotides
ATGGCGCCTCCGGCCCCCGGCCCGGCCTCCGGCGGCTCCGGGGAGGTAGACGAGCTGTTCGACGTAAAGA ACGCCTTCTACATCGGCAGCTACCAGCAGTGCATAAACGAGGCGCAGCGGGTGAAGCTATCAAGCCCAGA GAGAGACGTGGAGAGGGACGTCTTCCTGTATAGAGCGTACCTGGCGCAGAGGAAGTTCGGTGTGGTCCTG GATGAGATCAAGCCCTCCTCGGCCCCTGAGCTCCAGGCCGTGCGCATGTTTGCTGACTACCTCGCCCACG AGAGTCGGAGGGACAGCATCGTGGCCGAGCTGGACCGAGAGATGAGCAGGAGCGTGGACGTGACCAACAC CACCTTCCTGCTCATGGCCGCCTCCATCTATCTCCACGACCAGAACCCGGATGCCGCCCTGCGTGCGCTG CACCAGGGGGACAGCCTGGAGTGCACAGCCATGACAGTGCAGATCCTGCTGAAGCTGGACCGCCTGGACC TCGCCCGGAAGGAGCTGAAGAGAATGCAGGACCTGGACGAGGATGCCACCCTCACCCAGCTCGCCACTGC CTGGGTCAGCCTGGCCACGGATAGTGGCTACCCAGAGACGCTGGTCAACCTCATCGTCCTGTCCCAGCAC CTGGGCAAGCCCCCTGAGGTGACAAACCGATACCTGTCCCAGCTGAAGGATGCCCACAGGTCCCATCCCT TCATCAAGGAGTACCAGGCCAAGGAGAACGACTTTGACAGGCTGGTGCTACAGTACGCTCCCAGCGCCTG A |
Restriction Sites | SgfI-MluI |
ACCN | NM_199444 |
ORF Size | 771 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_199444.1, NP_955476.1 |
RefSeq Size | 978 |
RefSeq ORF | 771 |
Locus ID | 11316 |
Gene Summary | The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (c), that is missing an internal segment compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224651 | COPE (Myc-DDK-tagged)-Human coatomer protein complex, subunit epsilon (COPE), transcript variant 3 |
USD 420.00 |
|
RG224651 | COPE (GFP-tagged) - Human coatomer protein complex, subunit epsilon (COPE), transcript variant 3 |
USD 460.00 |
|
RC224651L3 | Lenti ORF clone of Human coatomer protein complex, subunit epsilon (COPE), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC224651L4 | Lenti ORF clone of Human coatomer protein complex, subunit epsilon (COPE), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review