COPE (NM_199444) Human Untagged Clone

CAT#: SC307979

COPE (untagged)-Human coatomer protein complex, subunit epsilon (COPE), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COPE
• Synonyms: epsilon-COP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199444, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGCCTCCGGCCCCCGGCCCGGCCTCCGGCGGCTCCGGGGAGGTAGACGAGCTGTTCGACGTAAAGA
  ACGCCTTCTACATCGGCAGCTACCAGCAGTGCATAAACGAGGCGCAGCGGGTGAAGCTATCAAGCCCAGA
  GAGAGACGTGGAGAGGGACGTCTTCCTGTATAGAGCGTACCTGGCGCAGAGGAAGTTCGGTGTGGTCCTG
  GATGAGATCAAGCCCTCCTCGGCCCCTGAGCTCCAGGCCGTGCGCATGTTTGCTGACTACCTCGCCCACG
  AGAGTCGGAGGGACAGCATCGTGGCCGAGCTGGACCGAGAGATGAGCAGGAGCGTGGACGTGACCAACAC
  CACCTTCCTGCTCATGGCCGCCTCCATCTATCTCCACGACCAGAACCCGGATGCCGCCCTGCGTGCGCTG
  CACCAGGGGGACAGCCTGGAGTGCACAGCCATGACAGTGCAGATCCTGCTGAAGCTGGACCGCCTGGACC
  TCGCCCGGAAGGAGCTGAAGAGAATGCAGGACCTGGACGAGGATGCCACCCTCACCCAGCTCGCCACTGC
  CTGGGTCAGCCTGGCCACGGATAGTGGCTACCCAGAGACGCTGGTCAACCTCATCGTCCTGTCCCAGCAC
  CTGGGCAAGCCCCCTGAGGTGACAAACCGATACCTGTCCCAGCTGAAGGATGCCCACAGGTCCCATCCCT
  TCATCAAGGAGTACCAGGCCAAGGAGAACGACTTTGACAGGCTGGTGCTACAGTACGCTCCCAGCGCCTG
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_199444
• ORF Size: 771 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_199444.1, NP_955476.1
• RefSeq Size: 978
• RefSeq ORF: 771
• Locus ID: 11316
• Gene Summary: The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (c), that is missing an internal segment compared to isoform a.