ZNF365 (NM_199452) Human Untagged Clone

CAT#: SC307981

ZNF365 (untagged)-Human zinc finger protein 365 (ZNF365), transcript variant D

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNF365
• Synonyms: Su48; UAN; ZNF365D
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199452, the custom clone sequence may differ by one or more nucleotides
  ATGTCTGCGCTGGGTCAGATAACCATCACTGTCTCCAGGTGCTGGAATACAGAGAGGAAC
  CAAACAGATAAAAATCCTTGCCTGCACGGAGCTTACCTTCAGCTAAGGGAGACAGTCAAA
  AACAAGTCAACACATCTAAAGAAGCCACTGATGAAACAGGCTCCCCCTTGGAAAGACCAT
  CTCACCTTCCAACCTCTCCATCCTGCAGAGAGGAAAACCCAAGTTTGGCGTTGGCAGTCA
  GGTAATTCATCAGATCTGGAAACCACCTCATCAGCATCCCCCTGGCCAACTGGAAGCAAC
  CGTGACGTTGTGCTGAATACACTTGCAGAGTCGTGCTGTGGTCTCTCCGAGCTCATCACG
  GCACCTCCCTATGCAGGAGTTTCAATTCAAGGATTTAGCCAAATTTGGGTGCTATTTCCC
  TTTTGTGGAGGGACTTTTCATCACAATGAGAAGGACGTCTTAGGACTCCAGGACTTTGAG
  AGAGAAAGTGTCTCTACAAGTCAAAGCAGGAATATCAGCCTTCTTACACTAGGACAACTC
  CAAAATTGTGTGATTGGCAAATTGACAATCATCGATTTGTTGACTGAACACCTGTTAGGT
  GTAAGGCACGGTGTCATATGCTTTCCTTGGGGCTTGCCTTCAAGCAGCTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_199452
• ORF Size: 651 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_199452.1, NP_955524.1
• RefSeq Size: 2695
• RefSeq ORF: 651
• Locus ID: 22891
• Gene Summary: This gene encodes several isoforms which have different expression patterns and functions. Mutation in this gene is associated with uric acid nephrolithiasis (UAN). Alternatively spliced variants, encoding distinct proteins, have been identified. [provided by RefSeq, May 2010]
  Transcript Variant: This variant (D) differs in the 5' coding region and UTR, and has multiple coding region differences. These differences cause translation initiation at an alternate start codon compared to variant C. The resulting protein (isoform D) is shorter and has a distinct N-terminus compared to isoform C. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.