KCNRG (NM_199464) Human Untagged Clone

CAT#: SC307987

KCNRG (untagged)-Human potassium channel regulator (KCNRG), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCNRG
• Synonyms: DLTET
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199464, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTAGTCAGGAACTGGTCACTTTGAATGTGGGAGGGAAGATATTCACGACAAGGTTTTCTACGATAA
  AGCAGTTTCCTGCTTCTCGTTTGGCACGCATGTTAGATGGCAGAGACCAAGAATTCAAGATGGTTGGTGG
  CCAGATTTTTGTAGACAGAGATGGTGATTTGTTTAGTTTCATCTTAGATTTTTTGAGAACTCACCAGCTT
  TTATTACCCACTGAATTTTCAGACTATCTTAGGCTTCAGAGAGAGGCTCTTTTCTATGAACTTCGTTCTC
  TAGTTGATCTCTTAAACCCATACCTGCTACAGCCAAGACCTGCTCTTGTGGAGGTACATTTCCTAAGCCG
  GAACACTCAAGCTTTTTTCAGGGTGTTTGGCTCTTGCAGCAAAACAATTGAGATGCTAACAGGGAGGATT
  ACAGTGTTTACAGAACAACCTTCAGCGCCGACCTGGAATGGTAACTTTTTCCCTCCTCAGATGACCTTAC
  TTCCACTGCCTCCACAAAGACCTTCTTACCATGACCTGGTTTTCCAGTGTGGTTCTGACAGCACTACTGA
  TAACCAAACTGGAGTCAGGCTGGTATGCAATGGCGTGATCTCGGCTCACCACAACCTCCGCCTCTGGGGT
  TCAAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGTATGTTTCTATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_199464
• ORF Size: 690 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_199464.2, NP_955751.1
• RefSeq Size: 1639
• RefSeq ORF: 690
• Locus ID: 283518
• Gene Summary: This gene encodes a protein which regulates the activity of voltage-gated potassium channels. This gene is on chromosome 13 and overlaps the gene for tripartite motif containing 13 on the same strand. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
  Transcript Variant: This variant (2) contains an alternate exon which results in a frameshift compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1.