UQCC (UQCC1) (NM_199487) Human Untagged Clone

CAT#: SC307991

UQCC (untagged)-Human ubiquinol-cytochrome c reductase complex chaperone (UQCC), nuclear gene encoding mitochondrial protein, transcript variant 2


  "NM_199487" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "UQCC1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UQCC1
Synonyms BFZB; C20orf44; CBP3; UQCC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_199487, the custom clone sequence may differ by one or more nucleotides


ATGGCGTTGCTGGTGCGAGTCCTTAGGAACCAGACTAGCATTTCTCAGTGGGTTCCAGTATGCAGCCGAT
TGATACCTGTGTCTCCTACCCAAGGACAGGGGGACAGGGCTCTGTCTCGCACTTCCCAGTGGCCCCAGAT
GAGCCAGTCCCGAGCATGTGGTGGATCAGAACAGATTCCTGGAATAGACATACAGCTGAATAGGAAGTAT
CACACCACACGTAAGCTTTCTACTACCAAAGATTCCCCACAGCCTGTTGAGGAGAAGGTTGGTGCTTTCA
CAAAGATAATAGAAGCCATGGGATTCACGGGACCTTTGAAATACAGTAAATGGAAGATTAAGATTGCGGC
CCTGCGCATGTATACTAGCTGTGTGGAGAAAACTGACTTCGAGGAATTCTTTCTAAGGTGTCAGATGCCT
GATACATTCAATTCATGGTTTCTTATAACCCTACTCCACGTCTGGATGTGTCTAGTCCGAATGAAGCAGG
AAGGCCGGAGTGGGAAGTACATGTGTCGTATCATAGTTCATTTTATGTGGGAGGATGTTCAGCAGCGCGG
CAGAGTCATGGGGGGGATCCTTTCAGATGATCATGGGCTGGCCGCTGCCCTCTGGAGAACCTTCTTCAAC
CGGAAATGTGAAGACCCTCGACATCTTGAATTGCTGGTAGAGTATGTGAGGAAACAGATACAGTACCTGG
ACTCCATGAACGGGGAGGATCTGCTTCTGACAGGGGAGGTGAGCTGGCGCCCTCTAGTGGAGAAGAATCC
TCAGAGCATCCTGAAGCCCCATTCTCCGACTTACAACGACGAGGGACTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_199487
ORF Size 822 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_199487.2, NP_955781.2
RefSeq Size 2383
RefSeq ORF 822
Locus ID 55245
Gene Summary This gene encodes a transmembrane protein that is structurally similar to the mouse basic fibroblast growth factor repressed ZIC-binding protein. In mouse this protein may be involved in fibroblast growth factor regulated growth control. In humans, polymorphisms in this gene are associated with variation in human height and osteoarthritis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (2) lacks an in-frame exon compared to variant 1. The resulting isoform (b) is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.