RNF90 (TRIM7) (NM_203294) Human Untagged Clone

CAT#: SC308105

TRIM7 (untagged)-Human tripartite motif containing 7 (TRIM7), transcript variant 5


  "NM_203294" in other vectors (4)

Reconstitution Protocol

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TRIM7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TRIM7
Synonyms GNIP; RNF90
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_203294, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCGGAGCAGGAGAAGGTGGGGGCAGAGTTCCAGGCACTGAGGGCTTTCCTGGTG
GAGCAGGAGGGTCGGCTGCTAGGCCGCCTGGAGGAACTGTCCCGGGAGGTGGCACAGAAG
CAGAATGAGAACCTGGCCCAGCTCGGGGTTGAGATCACCCAGCTGTCCAAGCTCAGCAGC
CAGATCCAGGAGACAGCTCAAAAGCCTGACCTTGACTTTCTCCAGGAATTCAAAAGCACG
CTGAGCAGGTGTAGCAATGTGCCTGGCCCCAAGCCAACCACAGTCTCTTCTGAGATGAAG
AATAAAGTCTGGAATGTTTCTCTCAAGACCTTTGTCTTAAAAGGGATGCTGAAGAAGTTC
AAAGAGGACCTTCGGGGAGAGCTGGAGAAAGAGGAGAAAGTGGAGCTCACCTTGGATCCC
GACACGGCCAACCCGCGCCTCATCCTCTCTCTGGATCTTAAGGGCGTGCGCCTCGGCGAG
CGGGCCCAGGACCTGCCCAACCACCCCTGCCGCTTCGACACCAACACCCGCGTCCTGGCG
TCCTGCGGCTTCTCCTCGGGCCGGCATCACTGGGAGGTGGAGGTGGGCTCTAAGGACGGC
TGGGCCTTTGGCGTGGCCCGCGAGAGCGTGCGCCGAAAGGGCCTGACGCCCTTCACTCCC
GAGGAGGGCGTCTGGGCCCTGCAGCTCAACGGCGGCCAGTACTGGGCCGTGACCAGCCCC
GAGCGGTCGCCCCTCAGCTGCGGGCACCTGTCGCGCGTGCGGGTGGCCCTGGACCTGGAG
GTGGGAGCCGTGTCCTTCTACGCTGTGGAGGACATGCGCCACCTCTACACCTTCCGCGTC
AACTTCCAGGAGCGCGTGTTCCCGCTTTTCTCTGTTTGCTCCACGGGCACCTACTTGCGA
ATCTGGCCTTGA
Restriction Sites Please inquire     
ACCN NM_203294
ORF Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_203294.1, NP_976039.1
RefSeq Size 2592
RefSeq ORF 912
Locus ID 81786
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (5, also known as GNIP2b) differs in the 5' UTR and the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. Variants 3, 4 and 5 encode the same isoform (3), which is shorter at the N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.