RNF90 (TRIM7) (NM_203296) Human Untagged Clone

CAT#: SC308107

TRIM7 (untagged)-Human tripartite motif containing 7 (TRIM7), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRIM7
• Synonyms: GNIP; RNF90
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_203296, the custom clone sequence may differ by one or more nucleotides
  ATGGCAGCGGAGCAGGAGAAGGTGGGGGCAGAGTTCCAGGCACTGAGGGCTTTCCTGGTG
  GAGCAGGAGGGTCGGCTGCTAGGCCGCCTGGAGGAACTGTCCCGGGAGGTGGCACAGAAG
  CAGAATGAGAACCTGGCCCAGCTCGGGGTTGAGATCACCCAGCTGTCCAAGCTCAGCAGC
  CAGATCCAGGAGACAGCTCAAAAGCCTGACCTTGACTTTCTCCAGGAATTCAAAAGCACG
  CTGAGCAGGTGTAGCAATGTGCCTGGCCCCAAGCCAACCACAGTCTCTTCTGAGATGAAG
  AATAAAGTCTGGAATGTTTCTCTCAAGACCTTTGTCTTAAAAGGGATGCTGAAGAAGTTC
  AAAGAGGACCTTCGGGGAGAGCTGGAGAAAGAGGAGAAAGTGGAGCTCACCTTGGATCCC
  GACACGGCCAACCCGCGCCTCATCCTCTCTCTGGATCTTAAGGGCGTGCGCCTCGGCGAG
  CGGGCCCAGGACCTGCCCAACCACCCCTGCCGCTTCGACACCAACACCCGCGTCCTGGCG
  TCCTGCGGCTTCTCCTCGGGCCGGCATCACTGGGAGGTGGAGGTGGGCTCTAAGGACGGC
  TGGGCCTTTGGCGTGGCCCGCGAGAGCGTGCGCCGAAAGGGCCTGACGCCCTTCACTCCC
  GAGGAGGGCGTCTGGGCCCTGCAGCTCAACGGCGGCCAGTACTGGGCCGTGACCAGCCCC
  GAGCGGTCGCCCCTCAGCTGCGGGCACCTGTCGCGCGTGCGGGTGGCCCTGGACCTGGAG
  GTGGGAGCCGTGTCCTTCTACGCTGTGGAGGACATGCGCCACCTCTACACCTTCCGCGTC
  AACTTCCAGGAGCGCGTGTTCCCGCTTTTCTCTGTTTGCTCCACGGGCACCTACTTGCGA
  ATCTGGCCTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_203296
• ORF Size: 912 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_203296.1, NP_976041.1
• RefSeq Size: 2869
• RefSeq ORF: 912
• Locus ID: 81786
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (3, also known as GNIP2c) differs in the 5' UTR and the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. Variants 3, 4 and 5 encode the same isoform (3), which is shorter at the N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.