SEP15 (NM_203341) Human Untagged Clone
CAT#: SC308125
41532 (untagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
"NM_203341" in other vectors (7)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Symbol | SELENOF |
Synonyms | SEP15 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_203341, the custom clone sequence may differ by one or more nucleotides
ATGGTAGCGATGGCGGCTGGGCCGAGTGGGTGTCTGGTGCCGGCGTTTGGGCTACGGTTGTTGTTGGCGA CTGTGCTTCAAGCGGTGTCTGCTTTTGGGGCAGAGTTTTCATCGGAGGCATGCAGAGAGTTAGGCTTTTC TAGCAACTTGCTTTGCAGCTCTTGTGATCTTCTCGGACAGTTCAACCTGCTTCAGCTGGATCCTGATTGC AGAGGATGCTGTCAGGAGGAAGCACAATTTGAAACCAAAAAGCTGTATGCAGGAGCTATTCTTGAAGTTT GTGGATGAAAATTGGGAAGGTTCCCTCAAGTCCAAGTATGTCCGTGGTTCAGACCCTGTATTAAAGCTTT TGGACGACAATGGGAACATTGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_203341 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
Reference Data | |
RefSeq | NM_203341.1, NP_976086.1 |
RefSeq Size | 1801 |
Locus ID | 9403 |
Gene Summary | The protein encoded by this gene belongs to the SEP15/selenoprotein M family. The exact function of this protein is not known; however, it has been found to associate with UDP-glucose:glycoprotein glucosyltransferase (UGTR), an endoplasmic reticulum(ER)-resident protein, which is involved in the quality control of protein folding. The association with UGTR retains this protein in the ER, where it may play a role in protein folding. It has also been suggested to have a role in cancer etiology. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2016] Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC321079 | 41532 (untagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
USD 420.00 |
|
RC205084 | SEP15 (Myc-DDK-tagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see reference data summary) |
USD 98.00 |
|
RG205084 | 41532 (GFP-tagged) - Human 15 kDa selenoprotein (SEP15), transcript variant 2, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
USD 460.00 |
|
RC205084L1 | Lenti-ORF, 41532 (Myc-DDK-tagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see summary) |
USD 620.00 |
|
RC205084L2 | Lenti-ORF, 41532 (mGFP-tagged) - Human 15 kDa selenoprotein (SEP15), transcript variant 2, (Note: selenocysteine protein, Internal stop codon present. See Summary below) |
USD 620.00 |
|
RC205084L3 | Lenti-ORF, 41532 (Myc-DDK-tagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see summary) |
USD 620.00 |
|
RC205084L4 | Lenti-ORF, 41532 (mGFP-tagged) - Human 15 kDa selenoprotein (SEP15), transcript variant 2, (Note: selenocysteine protein, Internal stop codon present. See Summary below) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review