Cyclophilin E (PPIE) (NM_203456) Human Untagged Clone

CAT#: SC308190

PPIE (untagged)-Human peptidylprolyl isomerase E (cyclophilin E) (PPIE), transcript variant 2


  "NM_203456" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPIE"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPIE
Synonyms CYP-33; CYP33
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_203456, the custom clone sequence may differ by one or more nucleotides


ATGGCCACCACCAAGCGCGTCTTGTACGTGGGTGGACTGGCAGAGGAAGTGGACGACAAAGTTCTTCATG
CTGCGTTCATTCCTTTTGGAGACATCACAGATATTCAGATTCCTCTGGATTATGAAACAGAAAAGCACCG
AGGATTTGCTTTTGTTGAATTTGAGTTGGCAGAGGATGCTGCAGCAGCTATCGACAACATGAATGAATCT
GAGCTTTTTGGACGTACAATTCGTGTCAATTTGGCCAAACCAATGAGAATTAAGGAAGGCTCTTCCAGGC
CAGTTTGGTCAGATGATGACTGGTTGAAGAAGTTTTCTGGGAAGACGCTTGAAGAGAATAAAGAGGAAGA
AGGGTCAGAGCCTCCCAAAGCAGAGACCCAGGAGGGAGAGCCCATTGCTAAAAAGGCCCGCTCAAATCCT
CAGGTGTACATGGACATCAAGATTGGGAACAAGCCGGCTGGCCGCATCCAGATGCTCCTGCGTTCTGATG
TCGTGCCCATGACAGCAGAGAATTTCCGCTGCCTGTGCACTCATGAAAAGGGCTTTGGCTTTAAGGGAAG
CAGCTTCCACCGCATCATCCCCCAGTTCATGTGCCAGGGCGGTGATTTCACAAACCACAATGGCACTGGG
GGCAAGTCCATCTATGGGAAGAAGTTCGATGATGAAAACTTTATCCTCAAGCATACGGGACCAGGTCTAC
TATCCATGGCCAACTCTGGCCCAAACACCAATGGCTCTCAGTTCTTCCTGACATGTGACAAGACAGACTG
GCTGGATGGCAAGCATGTGGTGTTTGGAGAGGTCACCGAAGGCCTAGATGTCTTGCGGCAAATTGAGAAA
CAAGAAGAGTCAGCAATTACCAGCCAGCCGAGGTCCTGGAAGCTGACGTAG


Restriction Sites SgfI-MluI     
ACCN NM_203456
ORF Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_203456.2, NP_982281.1
RefSeq Size 1136
RefSeq ORF 891
Locus ID 10450
Protein Families Transcription Factors
Protein Pathways Spliceosome
Gene Summary The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein contains a highly conserved cyclophilin (CYP) domain as well as an RNA-binding domain. It was shown to possess PPIase and protein folding activities, and it also exhibits RNA-binding activity. Alternative splicing results in multiple transcript variants. A related pseudogene, which is also located on chromosome 1, has been identified. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (2) uses an alternate 3' exon and thereby differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.