Cyclophilin E (PPIE) (NM_203456) Human Untagged Clone
CAT#: SC308190
PPIE (untagged)-Human peptidylprolyl isomerase E (cyclophilin E) (PPIE), transcript variant 2
"NM_203456" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PPIE |
Synonyms | CYP-33; CYP33 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_203456, the custom clone sequence may differ by one or more nucleotides
ATGGCCACCACCAAGCGCGTCTTGTACGTGGGTGGACTGGCAGAGGAAGTGGACGACAAAGTTCTTCATG CTGCGTTCATTCCTTTTGGAGACATCACAGATATTCAGATTCCTCTGGATTATGAAACAGAAAAGCACCG AGGATTTGCTTTTGTTGAATTTGAGTTGGCAGAGGATGCTGCAGCAGCTATCGACAACATGAATGAATCT GAGCTTTTTGGACGTACAATTCGTGTCAATTTGGCCAAACCAATGAGAATTAAGGAAGGCTCTTCCAGGC CAGTTTGGTCAGATGATGACTGGTTGAAGAAGTTTTCTGGGAAGACGCTTGAAGAGAATAAAGAGGAAGA AGGGTCAGAGCCTCCCAAAGCAGAGACCCAGGAGGGAGAGCCCATTGCTAAAAAGGCCCGCTCAAATCCT CAGGTGTACATGGACATCAAGATTGGGAACAAGCCGGCTGGCCGCATCCAGATGCTCCTGCGTTCTGATG TCGTGCCCATGACAGCAGAGAATTTCCGCTGCCTGTGCACTCATGAAAAGGGCTTTGGCTTTAAGGGAAG CAGCTTCCACCGCATCATCCCCCAGTTCATGTGCCAGGGCGGTGATTTCACAAACCACAATGGCACTGGG GGCAAGTCCATCTATGGGAAGAAGTTCGATGATGAAAACTTTATCCTCAAGCATACGGGACCAGGTCTAC TATCCATGGCCAACTCTGGCCCAAACACCAATGGCTCTCAGTTCTTCCTGACATGTGACAAGACAGACTG GCTGGATGGCAAGCATGTGGTGTTTGGAGAGGTCACCGAAGGCCTAGATGTCTTGCGGCAAATTGAGAAA CAAGAAGAGTCAGCAATTACCAGCCAGCCGAGGTCCTGGAAGCTGACGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_203456 |
ORF Size | 891 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_203456.2, NP_982281.1 |
RefSeq Size | 1136 |
RefSeq ORF | 891 |
Locus ID | 10450 |
Protein Families | Transcription Factors |
Protein Pathways | Spliceosome |
Gene Summary | The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein contains a highly conserved cyclophilin (CYP) domain as well as an RNA-binding domain. It was shown to possess PPIase and protein folding activities, and it also exhibits RNA-binding activity. Alternative splicing results in multiple transcript variants. A related pseudogene, which is also located on chromosome 1, has been identified. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (2) uses an alternate 3' exon and thereby differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212849 | PPIE (Myc-DDK-tagged)-Human peptidylprolyl isomerase E (cyclophilin E) (PPIE), transcript variant 2 |
USD 420.00 |
|
RG212849 | PPIE (GFP-tagged) - Human peptidylprolyl isomerase E (cyclophilin E) (PPIE), transcript variant 2 |
USD 460.00 |
|
RC212849L3 | Lenti ORF clone of Human peptidylprolyl isomerase E (cyclophilin E) (PPIE), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC212849L4 | Lenti ORF clone of Human peptidylprolyl isomerase E (cyclophilin E) (PPIE), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review