PPIL5 (LRR1) (NM_203467) Human Untagged Clone

CAT#: SC308198

LRR1 (untagged)-Human leucine rich repeat protein 1 (LRR1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LRR1
• Synonyms: 4-1BBLRR; LRR-1; PPIL5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_203467, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCTACACTGTGAGGTGGAGGTGATCAGCCGGCACTTGCCCGCCTTGGGGCTTAGGAACCGGGGCA
  AGGGCGTCCGAGCCGTGTTGAGCCTCTGTCAGCAGACTTCCAGGAGTCAGCCGCCGGTCCGAGCCTTCCT
  GCTCATCTCCACCCTGAAGGACAAGCGCGGGACCCGCTATGAGCTAAGGGAGAACATTGAGCAATTCTTC
  ACCAAATTTGTAGATGAGGGGAAAGCCACTGTTCGGTTAAAGGAGCCTCCTGTGGATATCTGTCTAAGTA
  AGGATTCCATATGGCTCTCATATCATTCCATTCCATCTCTGCCAAGATTTGGATACCGCAAAAATTTGTG
  TTTGTGGAAGATTCTGTCTGAACTCTTTCATTCAAGGAACTACTACCATGAATCTGCATTCTGTTGCCCA
  CACTGTGGTCTTAGTAGATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_203467
• ORF Size: 441 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_203467.1, NP_982292.1
• RefSeq Size: 1049
• RefSeq ORF: 441
• Locus ID: 122769
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene contains a leucine-rich repeat (LRR). It specifically interacts with TNFRSF9/4-1BB, a member of the tumor necrosis factor receptor (TNFR) superfamily. Overexpression of this gene suppresses the activation of NF-kappa B induced by TNFRSF9 or TNF receptor-associated factor 2 (TRAF2), which suggests that this protein is a negative regulator of TNFRSF9-mediated signaling cascades. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (3) lacks a coding region exon which leads to a frameshift, compared to variant 1. The resulting isoform (3) has a distinct and shorter C-terminus, as compared to isoform 1. Isoform 3 has also been named LRR-1b.