MRAP (NM_206898) Human Untagged Clone

CAT#: SC308307

MRAP (untagged)-Human melanocortin 2 receptor accessory protein (MRAP), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MRAP
• Synonyms: B27; C21orf61; FALP; FGD2; GCCD2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_206898 edited
  GGCCATTACGGCCGGGGACCCACAGACACACTTGGACGATTCCTGCAGAAATCAGTGAGG
  CAGTCTCCTCCCAGGGGCTTGGCGCCTGGCTCGAGGCGAGGCTGCCGGCCCGGACGCTGA
  CTGCCCAGTGCCACAGACATGGCCAACGGGACCAACGCCTCTGCCCCATACTACAGCTAT
  GAATACTACCTGGACTATCTGGACCTCATTCCCGTGGACGAGAAGAAGCTGAAAGCCCAC
  AAACATTCCATCGTGATCGCATTCTGGGTTAGCCTGGCTGCCTTCGTGGTGCTGCTCTTC
  CTCATCTTGCTCTACATGTCCTGGTCCGCCTCCCCGCAGATGAGCTTTAACACAGATGAA
  TCTCTTCTGCATTCAGAAGTGCTGCCTCAAACTCGAGCTATTTCCTGTGATGAGCTCCAA
  GCCCCTAGAGAGGAAGGGGCGGCCTGACGAGGCACTGGATGGGCCTCATGGCCTAGAAGT
  CCCCACATTCCTTGCAACTCTGATGCTG
  
• Restriction Sites: Please inquire
• ACCN: NM_206898
• ORF Size: 309 bp
• Insert Size: 600
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The open reading frame of this clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_206898.1. This SNP doesn't change amino acid.

Reference Data

• RefSeq: NM_206898.1, NP_996781.1
• RefSeq Size: 656
• RefSeq ORF: 309
• Locus ID: 56246
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a melanocortin receptor-interacting protein. The encoded protein regulates trafficking and function of the melanocortin 2 receptor in the adrenal gland. The encoded protein can also modulate signaling of other melanocortin receptors. Mutations in this gene have been associated with familial glucocorticoid deficiency type 2. Alternatively spliced transcript variants have been described. [provided by RefSeq, Dec 2009]
  Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 1. The resulting isoform (beta) is shorter and has a distinct C-terminus compared to isoform alpha.