MS4A7 (NM_206940) Human Untagged Clone

CAT#: SC308335

MS4A7 (untagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 4


  "NM_206940" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MS4A7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MS4A7
Synonyms 4SPAN2; CD20L4; CFFM4; MS4A8
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_206940, the custom clone sequence may differ by one or more nucleotides
ATGCTATTACAATCCCAAACCATGGGGGTTTCTCACAGCTTTACACCAAAGGGCATCACT
ATCCCTCAAAGAGAGAAACCTGGACACATGTACCAAAACGAAGATTACCTGCAGAACGGG
CTGCCAACAGAAACCACCGTTCTTGGGTTTGGCATTACTGGATCCCTCTCAATTATCTCT
GGAAAACAATCAACTAAGCCCTTTGACCTGAGCAGCTTGACCTCAAATGCAGTGAGTTCT
GTTACTGCAGGAGCAGGCCTCTTCCTCCTTGCTGACAGCATGGTAGCCCTGAGGACTGCC
TCTCAACATTGTGGCTCAGAAATGGATTATCTATCCTCATTGCCTTATTCGGAGTACTAT
TATCCAATATATGAAATCAAAGATTGTCTCCTGACCAGTGTCAGTTTAACAGGTGTCCTA
GTGGTGATGCTCATCTTCACTGTGCTGGAGCTCTTATTAGCTGCATACAGTTCTGTCTTT
TGGTGGAAACAGCTCTACTCCAACAACCCTGGGAGTTCATTTTCCTCGACCCAGTCACAA
GATCATATCCAACAGGTCAAAAAGAGTTCTTCACGGTCTTGGATATAA
Restriction Sites Please inquire     
ACCN NM_206940
ORF Size 588 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_206940.1, NP_996823.1
RefSeq Size 2841
RefSeq ORF 588
Locus ID 58475
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a member of the membrane-spanning 4A gene family, members of which are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. This family member is associated with mature cellular function in the monocytic lineage, and it may be a component of a receptor complex involved in signal transduction. This gene is localized to 11q12, in a cluster of other family members. At least four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) uses an alternate splice site for the first exon and lacks an in-frame coding exon compared to variant 1. The resulting isoform (2) lacks an internal region, as compared to isoform 1. Variants 4 and 2 encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.