MS4A7 (NM_206940) Human Untagged Clone
CAT#: SC308335
MS4A7 (untagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 4
"NM_206940" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MS4A7 |
Synonyms | 4SPAN2; CD20L4; CFFM4; MS4A8 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_206940, the custom clone sequence may differ by one or more nucleotides
ATGCTATTACAATCCCAAACCATGGGGGTTTCTCACAGCTTTACACCAAAGGGCATCACT ATCCCTCAAAGAGAGAAACCTGGACACATGTACCAAAACGAAGATTACCTGCAGAACGGG CTGCCAACAGAAACCACCGTTCTTGGGTTTGGCATTACTGGATCCCTCTCAATTATCTCT GGAAAACAATCAACTAAGCCCTTTGACCTGAGCAGCTTGACCTCAAATGCAGTGAGTTCT GTTACTGCAGGAGCAGGCCTCTTCCTCCTTGCTGACAGCATGGTAGCCCTGAGGACTGCC TCTCAACATTGTGGCTCAGAAATGGATTATCTATCCTCATTGCCTTATTCGGAGTACTAT TATCCAATATATGAAATCAAAGATTGTCTCCTGACCAGTGTCAGTTTAACAGGTGTCCTA GTGGTGATGCTCATCTTCACTGTGCTGGAGCTCTTATTAGCTGCATACAGTTCTGTCTTT TGGTGGAAACAGCTCTACTCCAACAACCCTGGGAGTTCATTTTCCTCGACCCAGTCACAA GATCATATCCAACAGGTCAAAAAGAGTTCTTCACGGTCTTGGATATAA |
Restriction Sites | Please inquire |
ACCN | NM_206940 |
ORF Size | 588 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_206940.1, NP_996823.1 |
RefSeq Size | 2841 |
RefSeq ORF | 588 |
Locus ID | 58475 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the membrane-spanning 4A gene family, members of which are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. This family member is associated with mature cellular function in the monocytic lineage, and it may be a component of a receptor complex involved in signal transduction. This gene is localized to 11q12, in a cluster of other family members. At least four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) uses an alternate splice site for the first exon and lacks an in-frame coding exon compared to variant 1. The resulting isoform (2) lacks an internal region, as compared to isoform 1. Variants 4 and 2 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219524 | MS4A7 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 4 |
USD 420.00 |
|
RG219524 | MS4A7 (GFP-tagged) - Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 4 |
USD 460.00 |
|
RC219524L3 | Lenti-ORF clone of MS4A7 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 4 |
USD 620.00 |
|
RC219524L4 | Lenti-ORF clone of MS4A7 (mGFP-tagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review