ENSA (NM_207168) Human Untagged Clone

CAT#: SC308401

ENSA (untagged)-Human endosulfine alpha (ENSA), transcript variant 8


  "NM_207168" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ENSA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ENSA
Synonyms ARPP-19e
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_207168, the custom clone sequence may differ by one or more nucleotides


ATGTCCCAGAAACAAGAAGAAGAGAACCCTGCGGAGGAGACCGGCGAGGAGAAGCAGGACACGCAGGAGA
AAGAAGGTATTCTGCCTGAGAGAGCTGAAGAGGCAAAGCTAAAGGCCAAATACCCAAGCCTAGGACAAAA
GCCTGGAGGCTCCGACTTCCTCATGAAGAGACTCCAGAAAGGGGTATGGGGCATAGTCTCTTACCCTCTT
TCTTTGGAGCTAAAGGAGGTTCTTCGAATGAAGTCTGTAGAGGTTCTACTGGATCCTTTTCTGGAGGTTT
TGTTGTTGAACAGAAGTAGAGGCGAATTTGAAATTTGA


Restriction Sites SgfI-MluI     
ACCN NM_207168
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_207168.1, NP_997051.1
RefSeq Size 771 bp
RefSeq ORF 318 bp
Locus ID 2029
Cytogenetics 1q21.3
Protein Families Druggable Genome
Gene Summary 'The protein encoded by this gene belongs to a highly conserved cAMP-regulated phosphoprotein (ARPP) family. This protein was identified as an endogenous ligand for the sulfonylurea receptor, ABCC8/SUR1. ABCC8 is the regulatory subunit of the ATP-sensitive potassium (KATP) channel, which is located on the plasma membrane of pancreatic beta cells and plays a key role in the control of insulin release from pancreatic beta cells. This protein is thought to be an endogenous regulator of KATP channels. In vitro studies have demonstrated that this protein modulates insulin secretion through the interaction with KATP channel, and this gene has been proposed as a candidate gene for type 2 diabetes. At least eight alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (8) lacks multiple exons in the 3' region, and differs in the 3' end compared to variant 1. The resulting isoform (8) has a distinct and shorter C-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.