GCIP interacting protein p29 (SYF2) (NM_207170) Human Untagged Clone

CAT#: SC308402

SYF2 (untagged)-Human SYF2 homolog, RNA splicing factor (S. cerevisiae) (SYF2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SYF2
• Synonyms: CBPIN; fSAP29; NTC31; P29
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_207170, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCTATAGCTGCATCCGAGGTGCTGGTGGACAGCGCGGAGGAGGGGTCCCTCGCTGCGGCGGCGG
  AGCTGGCCGCTCAGAAGCGCGAACAGAGACTGCGCAAATTCCGGGAGCTGCACCTGATGCGGGAATGTGC
  GGCAAGAGGAGAAGACTATGAGAAAGTGAAGTTGCTGGAGATCAGTGCAGAAGATGCAGAAAGATGGGAG
  AGGAAAAAGAAGAGGAAAAACCCTGATCTGGGATTTTCAGATTATGCTGCTGCCCAGTTACGCCAGTATC
  ATCGGTTGACCAAGCAGATCAAACCTGACATGGAAACATATGAGAGACTGAGAGAAAAACATGGAGAAGA
  GTTTTTCCCAACATCCAATAGTCTTCTTCATGGAACACATGTGCCTTCCACAGAGGAAATTGACAGGATG
  GTCATAGATCTGGAAAAACAGATTGAAAAACGAGACAAATATAGCCGGAGACGTCCTTATAATGATGATG
  CAGATATCGACTACATTAATGAAAGGAATGCCAAATTCAACAAGAAAGCTGAAAGATTCTATGGGAAATA
  CACAGCTGAAATTAAACAGAATTTGGAAAGAGGAACAGCTGTCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_207170
• ORF Size: 606 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_207170.3, NP_997053.1
• RefSeq Size: 1651
• RefSeq ORF: 606
• Locus ID: 25949
• Protein Pathways: Spliceosome
• Gene Summary: This gene encodes a nuclear protein that interacts with cyclin D-type binding-protein 1, which is thought to be a cell cycle regulator at the G1/S transition. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an alternate exon, compared to variant 1, but maintains the reading frame. The resulting protein (isoform 2) is shorter than isoform 1 and lacks both bipartite nuclear localization signals found in isoform 1.