IFNAR2 (NM_207585) Human Untagged Clone
CAT#: SC308614
IFNAR2 (untagged)-Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 1
"NM_207585" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IFNAR2 |
Synonyms | IFN-alpha-REC; IFN-R; IFNABR; IFNARB; IMD45 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_207585 edited
ATGCTTTTGAGCCAGAATGCCTTCATCTTCAGATCACTTAATTTGGTTCTCATGGTGTAT ATCAGCCTCGTGTTTGGTATTTCATATGATTCGCCTGATTACACAGATGAATCTTGCACT TTCAAGATATCATTGCGAAATTTCCGGTCCATCTTATCATGGGAATTAAAAAACCACTCC ATTGTACCAACTCACTATACATTGCTGTATACAATCATGAGTAAACCAGAAGATTTGAAG GTGGTTAAGAACTGTGCAAATACCACAAGATCATTTTGTGACCTCACAGATGAGTGGAGA AGCACACACGAGGCCTATGTCACCGTCCTAGAAGGATTCAGCGGGAACACAACGTTGTTC AGTTGCTCACACAATTTCTGGCTGGCCATAGACATGTCTTTTGAACCACCAGAGTTTGAG ATTGTTGGTTTTACCAACCACATTAATGTGATGGTGAAATTTCCATCTATTGTTGAGGAA GAATTACAGTTTGATTTATCTCTCGTCATTGAAGAACAGTCAGAGGGAATTGTTAAGAAG CATAAACCCGAAATAAAAGGAAACATGAGTGGAAATTTCACCTATATCATTGACAAGTTA ATTCCAAACACGAACTACTGTGTATCTGTTTATTTAGAGCACAGTGATGAGCAAGCAGTA ATAAAGTCTCCCTTAAAATGCACCCTCCTTCCACCTGGCCAGGAATCAGAATCAGCAGAA TCTGCCAAAATAGGAGGAATAATTACTGTGTTTTTGATAGCATTGGTCTTGACAAGCACC ATAGTGACACTGAAATGGATTGGTTATATATGCTTAAGAAATAGCCTCCCCAAAGTCTTG AATTTTCATAACTTTTTAGCCTGGCCATTTCCTAACCTGCCACCGTTGGAAGCCATGGAT ATGGTGGAGGTCATTTACATCAACAGAAAGAAGAAAGTGTGGGATTATAATTATGATGAT GAAAGTGATAGCGATACTGAGGCAGCGCCCAGGACAAGTGGCGGTGGCTATACCATGCAT GGACTGACTGTCAGGCCTCTGGGTCAGGCCTCTGCCACCTCTACAGAATCCCAGTTGATA GACCCGGAGTCCGAGGAGGAGCCTGACCTGCCTGAGGTTGATGTGGAGCTCCCCACGATG CCAAAGGACAGCCCTCAGCAGTTGGAACTCTTGAGTGGGCCCTGTGAGAGGAGAAAGAGT CCACTCCAGGACCCTTTTCCCGAAGAGGACTACAGCTCCACGGAGGGGTCTGGGGGCAGA ATTACCTTCAATGTGGACTTAAACTCTGTGTTTTTGAGAGTTCTTGATGACGAGGACAGT GACGACTTAGAAGCCCCTCTGATGCTATCGTCTCATCTGGAAGAGATGGTTGACCCAGAG GATCCTGATAATGTGCAATCAAACCATTTGCTGGCCAGCGGGGAAGGGACACAGCCAACC TTTCCCAGCCCCTCTTCAGAGGGCCTGTGGTCCGAAGATGCTCCATCTGATCAAAGTGAC ACTTCTGAGTCAGATGTTGACCTTGGGGATGGTTATATAATGAGATGA |
Restriction Sites | Please inquire |
ACCN | NM_207585 |
Insert Size | 1500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_207585.1. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_207585.1, NP_997468.1 |
RefSeq Size | 2898 bp |
RefSeq ORF | 1548 bp |
Locus ID | 3455 |
Cytogenetics | 21q22.11 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Toll-like receptor signaling pathway |
Gene Summary | 'The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The protein belongs to the type II cytokine receptor family. Mutations in this gene are associated with Immunodeficiency 45. [provided by RefSeq, Jul 2020]' Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1 and 4 both encode isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218039 | IFNAR2 (Myc-DDK-tagged)-Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 1 |
USD 470.00 |
|
RG218039 | IFNAR2 (GFP-tagged) - Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 1 |
USD 520.00 |
|
RC218039L1 | Lenti-ORF clone of IFNAR2 (Myc-DDK-tagged)-Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 1 |
USD 828.00 |
|
RC218039L2 | Lenti-ORF clone of IFNAR2 (mGFP-tagged)-Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 1 |
USD 670.00 |
|
RC218039L3 | Lenti-ORF clone of IFNAR2 (Myc-DDK-tagged)-Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 1 |
USD 670.00 |
|
RC218039L4 | Lenti-ORF clone of IFNAR2 (mGFP-tagged)-Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 1 |
USD 828.00 |
{0} Product Review(s)
Be the first one to submit a review