Calpain 3 (CAPN3) (NM_212467) Human Untagged Clone

CAT#: SC308630

CAPN3 (untagged)-Human calpain 3, (p94) (CAPN3), transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CAPN3
• Synonyms: CANP3; CANPL3; LGMD2; LGMD2A; MGC4403; MGC10767; MGC11121; MGC14344; nCL-1; p94
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_212467 edited
  GAATTCATGAGTTGGCAAATCAGTTTAAAAACACAAACTACCCAACAGAAAAATGAAATT
  TGCGAGAATCCCCGATTTATCATTGATGGAGCCAACAGAACTGACATCTGTCAAGGAGAG
  CTAGACGGGTTCCAGGGCAGCTGCCTACCTGGCCTTCCTTCCAATACAAATCATCTTGGT
  GGATGGTTCTCTGAGGCTCAGTCTTCGCTGAAGTCAGAAGAGGAATTGGACTCACATTGC
  AAAGGCACAGGGCAGGGCAGATTTCCTACAGGTGTTAGGAAGAACAACCCAGTTATGATC
  ACCTACTGCTCTGTCTCCATTGAGGCCTAAAAGCTT
  
• Restriction Sites: Please inquire
• ACCN: NM_212467
• Insert Size: 324 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this and other two mentioned colonies have been fully sequenced and proven to be a perfect match to the published NM_212467.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_212467.1, NP_997632.1
• RefSeq Size: 3521 bp
• RefSeq ORF: 324 bp
• Locus ID: 825
• Cytogenetics: 15q15.1
• Protein Families: Druggable Genome, Protease
• Gene Summary: 'Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (9) is generated from an alternate promoter; it has 5 alternate 5' exons and an additional middle exon, and lacks an internal exon in the 3' region, as compared to variant 1. It encodes isoform h, which has shorter and distinct N- and C-termini compared to isoform a.