TCF7 (NM_213648) Human Untagged Clone

CAT#: SC308693

TCF7 (untagged)-Human transcription factor 7 (T-cell specific, HMG-box) (TCF7), transcript variant 5


  "NM_213648" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TCF7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TCF7
Synonyms TCF-1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_213648, the custom clone sequence may differ by one or more nucleotides
ATGTACAAAGAGACCGTCTACTCCGCCTTCAATCTGCTCATGCATTACCCACCCCCCTCG
GGAGCAGGGCAGCACCCCCAGCCGCAGCCCCCGCTGCACAAGGCCAATCAGCCCCCCCAC
GGTGTCCCCCAACTCTCTCTCTACGAACATTTCAACAGCCCACATCCCACCCCTGCACCT
GCGGACATCAGCCAGAAGCAAGTTCACAGGCCTCTGCAGACCCCTGACCTCTCTGGCTTC
TACTCCCTGACCTCAGGCAGCATGGGGCAGCTCCCCCACACTGTGAGCTGGTTCACCCAC
CCATCCTTGATGCTAGGTTCTGGTGTACCTGGTCACCCAGCAGCCATCCCCCACCCGGCC
ATTGTGCCCCCCTCAGGGAAGCAGGAGCTGCAGCCCTTCGACCGCAACCTGAAGACACAA
GCAGAGTCCAAGGCAGAGAAGGAGGCCAAGAAGCCAACCATCAAGAAGCCCCTCAATGCC
TTCATGCTGTACATGAAGGAGATGAGAGCCAAGGTCATTGCAGAGTGCACACTTAAGGAG
AGCGCTGCCATCAACCAGATCCTGGGCCGCAGGTGGCACGCGCTGTCGCGAGAAGAGCAG
GCCAAGTACTATGAGCTGGCCCGCAAGGAGAGGCAGCTGCACATGCAGCTATACCCAGGC
TGGTCAGCGCGGGACAACTACGGGAAGAAGAAGAGGCGGTCGAGGGAAAAGCACCAAGAA
TCCACCACAGGAGGAAAAAGAAATGCATTCGGTACTTACCCGGAGAAGGCCGCTGCCCCA
GCCCCGTTCCTTCCGATGACAGTGCTCTAG
Restriction Sites Please inquire     
ACCN NM_213648
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_213648.1, NP_998813.1
RefSeq Size 2944 bp
RefSeq ORF 810 bp
Locus ID 6932
Cytogenetics 5q31.1
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Protein Pathways Acute myeloid leukemia, Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Melanogenesis, Pathways in cancer, Prostate cancer, Thyroid cancer, Wnt signaling pathway
Gene Summary 'This gene encodes a member of the T-cell factor/lymphoid enhancer-binding factor family of high mobility group (HMG) box transcriptional activators. This gene is expressed predominantly in T-cells and plays a critical role in natural killer cell and innate lymphoid cell development. The encoded protein forms a complex with beta-catenin and activates transcription through a Wnt/beta-catenin signaling pathway. Mice with a knockout of this gene are viable and fertile, but display a block in T-lymphocyte differentiation. Alternative splicing results in multiple transcript variants. Naturally-occurring isoforms lacking the N-terminal beta-catenin interaction domain may act as dominant negative regulators of Wnt signaling. [provided by RefSeq, Oct 2016]'
Transcript Variant: This variant (5) differs in the 5' UTR, has multiple coding region differences, and uses a downstream start codon, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, compared to isoform 1. Both variants 2 and 5 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.