Angiotensin II Type 1 Receptor (AGTR1) (NM_032049) Human Untagged Clone

CAT#: SC308760

AGTR1 (untagged)-Human angiotensin II receptor, type 1 (AGTR1), transcript variant 5


  "NM_032049" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "AGTR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AGTR1
Synonyms AG2S; AGTR1B; AT1; AT1AR; AT1B; AT1BR; AT1R; AT2R1; HAT1R
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_032049, the custom clone sequence may differ by one or more nucleotides


ATGCTGACCTTCACCTCAGAGTGTGGCTGTACCACATTCGGTGTATTTGATATAGTGTTTGCAACAAATT
CGACCCAGGTGATCAAAATGATTCTCAACTCTTCTACTGAAGATGGTATTAAAAGAATCCAAGATGATTG
TCCCAAAGCTGGAAGGCATAATTACATATTTGTCATGATTCCTACTTTATACAGTATCATCTTTGTGGTG
GGAATATTTGGAAACAGCTTGGTGGTGATAGTCATTTACTTTTATATGAAGCTGAAGACTGTGGCCAGTG
TTTTTCTTTTGAATTTAGCACTGGCTGACTTATGCTTTTTACTGACTTTGCCACTATGGGCTGTCTACAC
AGCTATGGAATACCGCTGGCCCTTTGGCAATTACCTATGTAAGATTGCTTCAGCCAGCGTCAGTTTCAAC
CTGTACGCTAGTGTGTTTCTACTCACGTGTCTCAGCATTGATCGATACCTGGCTATTGTTCACCCAATGA
AGTCCCGCCTTCGACGCACAATGCTTGTAGCCAAAGTCACCTGCATCATCATTTGGCTGCTGGCAGGCTT
GGCCAGTTTGCCAGCTATAATCCATCGAAATGTATTTTTCATTGAGAACACCAATATTACAGTTTGTGCT
TTCCATTATGAGTCCCAAAATTCAACCCTCCCGATAGGGCTGGGCCTGACCAAAAATATACTGGGTTTCC
TGTTTCCTTTTCTGATCATTCTTACAAGTTATACTCTTATTTGGAAGGCCCTAAAGAAGGCTTATGAAAT
TCAGAAGAACAAACCAAGAAATGATGATATTTTTAAGATAATTATGGCAATTGTGCTTTTCTTTTTCTTT
TCCTGGATTCCCCACCAAATATTCACTTTTCTGGATGTATTGATTCAACTAGGCATCATACGTGACTGTA
GAATTGCAGATATTGTGGACACGGCCATGCCTATCACCATTTGTATAGCTTATTTTAACAATTGCCTGAA
TCCTCTTTTTTATGGCTTTCTGGGGAAAAAATTTAAAAGATATTTTCTCCAGCTTCTAAAATATATTCCC
CCAAAAGCCAAATCCCACTCAAACCTTTCAACAAAAATGAGCACGCTTTCCTACCGCCCCTCAGATAATG
TAAGCTCATCCACCAAGAAGCCTGCACCATGTTTTGAGGTTGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_032049
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032049.3, NP_114438.2
RefSeq Size 2096 bp
RefSeq ORF 1167 bp
Locus ID 185
Cytogenetics 3q24
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Renin-angiotensin system, Vascular smooth muscle contraction
Gene Summary 'Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2020]'
Transcript Variant: This variant (5), also known as pC4, has two additional exons in the 5' region, but its 5' UTR end has not been determined, compared to variant 1. The resulting isoform (3) has a longer N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.