Angiotensin II Type 1 Receptor (AGTR1) (NM_032049) Human Untagged Clone
CAT#: SC308760
AGTR1 (untagged)-Human angiotensin II receptor, type 1 (AGTR1), transcript variant 5
"NM_032049" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AGTR1 |
Synonyms | AG2S; AGTR1B; AT1; AT1AR; AT1B; AT1BR; AT1R; AT2R1; HAT1R |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_032049, the custom clone sequence may differ by one or more nucleotides
ATGCTGACCTTCACCTCAGAGTGTGGCTGTACCACATTCGGTGTATTTGATATAGTGTTTGCAACAAATT CGACCCAGGTGATCAAAATGATTCTCAACTCTTCTACTGAAGATGGTATTAAAAGAATCCAAGATGATTG TCCCAAAGCTGGAAGGCATAATTACATATTTGTCATGATTCCTACTTTATACAGTATCATCTTTGTGGTG GGAATATTTGGAAACAGCTTGGTGGTGATAGTCATTTACTTTTATATGAAGCTGAAGACTGTGGCCAGTG TTTTTCTTTTGAATTTAGCACTGGCTGACTTATGCTTTTTACTGACTTTGCCACTATGGGCTGTCTACAC AGCTATGGAATACCGCTGGCCCTTTGGCAATTACCTATGTAAGATTGCTTCAGCCAGCGTCAGTTTCAAC CTGTACGCTAGTGTGTTTCTACTCACGTGTCTCAGCATTGATCGATACCTGGCTATTGTTCACCCAATGA AGTCCCGCCTTCGACGCACAATGCTTGTAGCCAAAGTCACCTGCATCATCATTTGGCTGCTGGCAGGCTT GGCCAGTTTGCCAGCTATAATCCATCGAAATGTATTTTTCATTGAGAACACCAATATTACAGTTTGTGCT TTCCATTATGAGTCCCAAAATTCAACCCTCCCGATAGGGCTGGGCCTGACCAAAAATATACTGGGTTTCC TGTTTCCTTTTCTGATCATTCTTACAAGTTATACTCTTATTTGGAAGGCCCTAAAGAAGGCTTATGAAAT TCAGAAGAACAAACCAAGAAATGATGATATTTTTAAGATAATTATGGCAATTGTGCTTTTCTTTTTCTTT TCCTGGATTCCCCACCAAATATTCACTTTTCTGGATGTATTGATTCAACTAGGCATCATACGTGACTGTA GAATTGCAGATATTGTGGACACGGCCATGCCTATCACCATTTGTATAGCTTATTTTAACAATTGCCTGAA TCCTCTTTTTTATGGCTTTCTGGGGAAAAAATTTAAAAGATATTTTCTCCAGCTTCTAAAATATATTCCC CCAAAAGCCAAATCCCACTCAAACCTTTCAACAAAAATGAGCACGCTTTCCTACCGCCCCTCAGATAATG TAAGCTCATCCACCAAGAAGCCTGCACCATGTTTTGAGGTTGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_032049 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_032049.3, NP_114438.2 |
RefSeq Size | 2096 bp |
RefSeq ORF | 1167 bp |
Locus ID | 185 |
Cytogenetics | 3q24 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Calcium signaling pathway, Neuroactive ligand-receptor interaction, Renin-angiotensin system, Vascular smooth muscle contraction |
Gene Summary | 'Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2020]' Transcript Variant: This variant (5), also known as pC4, has two additional exons in the 5' region, but its 5' UTR end has not been determined, compared to variant 1. The resulting isoform (3) has a longer N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216447 | AGTR1 (Myc-DDK-tagged)-Human angiotensin II receptor, type 1 (AGTR1), transcript variant 5 |
USD 420.00 |
|
RG216447 | AGTR1 (GFP-tagged) - Human angiotensin II receptor, type 1 (AGTR1), transcript variant 5 |
USD 460.00 |
|
RC216447L1 | Lenti ORF clone of Human angiotensin II receptor, type 1 (AGTR1), transcript variant 5, Myc-DDK-tagged |
USD 768.00 |
|
RC216447L2 | Lenti ORF clone of Human angiotensin II receptor, type 1 (AGTR1), transcript variant 5, mGFP tagged |
USD 620.00 |
|
RC216447L3 | Lenti ORF clone of Human angiotensin II receptor, type 1 (AGTR1), transcript variant 5, Myc-DDK-tagged |
USD 620.00 |
|
RC216447L4 | Lenti ORF clone of Human angiotensin II receptor, type 1 (AGTR1), transcript variant 5, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review