SNX22 (NM_024798) Human Untagged Clone

CAT#: SC308794

SNX22 (untagged)-Human sorting nexin 22 (SNX22)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SNX22
• Synonyms: FLJ13952
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_024798, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGGAAGTTCACATCCCGTCGGTGGGGCCCGAGGCCGAGGGGCCCAGGCAGAGCCCGGAGAAAAGCC
  ACATGGTGTTCCGAGTGGAGGTGCTGTGCAGCGGGCGCAGACACACGGTGCCAAGGCGCTACAGCGAGTT
  CCACGCGCTGCACAAGCGGATCAAGAAGCTGTACAAAGTGCCCGACTTCCCCTCGAAACGCCTGCCCAAC
  TGGAGGACCAGAGGGTTGGAACAGCGCCGGCAGGGCTTGGAGGCTTACATCCAGGGCATCCTGTACCTGA
  ACCAGGAGGTGCCCAAGGAGTTACTGGAATTCCTGAGACTTCGGCACTTCCCCACAGACCCCAAGGCTAG
  CAACTGGGGCACCCTGAGGGAGTTCCTGCCTGGCGACAGCAGCTCCCAGCAGCACCAGCGGCCTGTCCTG
  AGCTTCCATGTGGATCCCTATGTTTGCAACCCCTCCCCAGAGTCGCTGCCCAACGTGGTGGTGAATGGTG
  TGCTCCAGGGCCTCTACAGCTTCAGCATCAGCCCAGATAAAGCCCAGCCAAAGGCGGCCTGTCACCCTGC
  TCCTCTGCCACCGATGCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_024798
• ORF Size: 582 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_024798.2, NP_079074.2
• RefSeq Size: 3614
• RefSeq ORF: 582
• Locus ID: 79856
• Gene Summary: The protein encoded by this gene is a sorting nexin that is found in the cytoplasm, where it interacts with membrane-bound phosphatidylinositol 3-phosphate. The encoded protein may play a role in intracellular trafficking. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Dec 2012]
  Transcript Variant: This variant (1) represents the protein-coding transcript.