COP (CARD16) (NM_052889) Human Untagged Clone

CAT#: SC309071

CARD16 (untagged)-Human caspase recruitment domain family, member 16 (CARD16), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CARD16
• Synonyms: COP; COP1; PSEUDO-ICE
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_052889 edited
  ATCTGGTACCGGTCCGGAATTCCCGGGATGAGAAAAGCCATGGCCGACAAGGTCCTGAAG
  GAGAAGAGAAAGCTGTTTATCCATTCCATGGGTGAAGGTACAATAAATGGCTTACTGGAT
  GAATTATTACAGACAAGGGTGCTGAACCAGGAAGAGATGGAGAAAGTAAAACGTGAAAAT
  GCTACAGTTATGGATAAGACCCGAGCTTTGATTGACTCCGTTATTCCGAAAGGGGCACAG
  GCATGCCAAATTTGCATCACATACATTTGTGAAGAAGACAGTTACCTGGCAGAGACGCTG
  GGACTCTCAGCAGGTCCGATACCTGGAAATTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_052889
• ORF Size: 294 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.

Reference Data

• RefSeq: NM_052889.2, NP_443121.1
• RefSeq Size: 758
• RefSeq ORF: 294
• Locus ID: 114769