KCNC4 (NM_153763) Human Untagged Clone

CAT#: SC309151

KCNC4 (untagged)-Human potassium voltage-gated channel, Shaw-related subfamily, member 4 (KCNC4), transcript variant 2


  "NM_153763" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNC4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNC4
Synonyms HKSHIIIC; KSHIIIC; KV3.4; MGC126818
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_153763, the custom clone sequence may differ by one or more nucleotides


ATGATCAGCTCGGTGTGTGTCTCCTCCTACCGCGGGCGCAAGTCGGGGAACAAGCCTCCGTCCAAAACAT
GTCTGAAGGAGGAGATGGCCAAGGGCGAGGCGTCGGAGAAGATCATCATCAACGTGGGCGGCACGCGACA
TGAGACCTACCGCAGCACCCTGCGCACCCTACCGGGAACCCGCCTCGCCTGGCTGGCCGACCCCGACGGC
GGGGGCCGGCCCGAGACCGATGGCGGCGGTGTGGGTAGCAGCGGCAGCAGCGGCGGCGGGGGCTGCGAGT
TCTTCTTCGACAGGCACCCGGGCGTCTTCGCCTACGTGCTCAACTACTACCGCACCGGCAAGCTGCACTG
CCCCGCGGACGTGTGCGGGCCGCTCTTCGAAGAGGAGCTCACCTTCTGGGGCATCGACGAGACCGACGTG
GAACCCTGCTGCTGGATGACCTACCGGCAGCACCGCGACGCCGAGGAGGCGCTCGACATCTTCGAGAGCC
CGGACGGAGGCGGCAGCGGCGCGGGGCCCAGCGACGAGGCCGGCGACGATGAGCGGGAGCTGGCCCTGCA
GCGACTGGGCCCCCACGAGGGAGGCGCGGGCCATGGCGCCGGGTCTGGGGGCTGCCGCGGCTGGCAGCCC
CGCATGTGGGCGCTCTTCGAGGATCCCTACTCCTCCCGGGCCGCTAGGGTAGTGGCCTTTGCCTCTCTCT
TCTTCATCCTGGTCTCCATCACCACTTTCTGCCTGGAGACCCATGAGGCCTTTAATATCGACCGCAACGT
GACAGAGATCCTCCGCGTAGGGAACATCACCAGCGTGCACTTCCGGCGGGAGGTAGAGACAGAGCCCATC
CTGACCTACATCGAGGGCGTATGTGTGCTGTGGTTCACACTGGAGTTCCTGGTGCGCATCGTGTGCTGCC
CCGACACGCTGGACTTCGTCAAGAACCTGCTCAACATCATCGACTTTGTGGCCATCCTGCCCTTCTACCT
GGAGGTGGGGCTGAGCGGCCTGTCATCCAAGGCGGCCCGCGACGTGCTGGGCTTCCTGCGCGTGGTGCGC
TTCGTGCGCATCCTGCGTATCTTCAAGCTCACACGCCACTTCGTGGGGCTACGCGTGCTGGGCCACACCC
TGAGGGCCAGCACCAATGAGTTCCTGCTGCTTATCATCTTCCTGGCCCTGGGTGTGCTCATCTTTGCCAC
CATGATCTACTACGCTGAGCGCATTGGGGCCAGGCCCTCCGACCCTCGGGGTAATGACCACACCGACTTC
AAGAACATCCCCATTGGCTTCTGGTGGGCTGTGGTCACCATGACGACACTGGGCTACGGAGACATGTACC
CCAAGACGTGGTCAGGCATGCTGGTAGGGGCACTGTGTGCACTGGCTGGCGTGCTCACCATCGCCATGCC
GGTGCCTGTCATCGTCAACAACTTCGGCATGTACTACTCCCTGGCCATGGCCAAGCAGAAGCTGCCCAAG
AAACGGAAGAAGCACGTGCCACGGCCGGCGCAGCTGGAGTCACCCATGTACTGCAAGTCTGAGGAGACTT
CCCCCCGGGACAGCACCTGCAGTGATACCAGCCCCCCTGCCCGGGAAGAGGGTATGATCGAGAGGAAACG
GGCAGGTGAGATTAGGGGTTGGGAAGGAAAATCCCTTTTCCCCCAGTGGCCTAGGGAGTTTCCAAATGGA
CCTCAGACCTTGGGATTTGGCATGTGTTTTGTGTGGGGCTTCCCTAAGCATAAAGATGTGCCTTTATGA


Restriction Sites SgfI-RsrII     
ACCN NM_153763
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153763.2, NP_720198.1
RefSeq Size 1855 bp
RefSeq ORF 1749 bp
Locus ID 3749
Cytogenetics 1p13.3
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary 'The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. It generates atypical voltage-dependent transient current that may be important for neuronal excitability. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]'
Transcript Variant: This variant (2) is missing two 3' end exons found in transcript variant 1, resulting in an isoform (b) that is shorter with a distinct C-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.