BAGE5 (NM_182484) Human Untagged Clone

CAT#: SC309311

BAGE5 (untagged)-Human B melanoma antigen family, member 5 (BAGE5)


  "NM_182484" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "BAGE5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BAGE5
Synonyms CT2.5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_182484 edited
ATGGTGGTGGCAACAGAGATGGCAGCGCAGCTGGAGTGTTAGGAGGGCGGCCTGAGCGGT
AGGAGTGGGGCTGGAGCAGTAAGATGGCGGCCGGAGCGGTTTTTCTGGCATTGTCTGCCC
AGCTGCTCCAAGCCAGGCTGATGAAGGAGGAGTCCCCTGTGGTGAGCTGGAGGTTGGAGC
CTGAAGACGGCACAGCTCTGTGCTTCATCTTCTGAGGTTGTGGCAGCCACGGTGATGGAG
ACGGCAGCTCAACAGGAGCAATAGGAGGAGATGGAGTTTCACTGTGTCAGCCAGGGATAT
ACCAAA
Restriction Sites Please inquire     
ACCN NM_182484
ORF Size 132 bp
Insert Size 300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_182484.1.
Reference Data
RefSeq NM_182484.1, NP_872290.1
RefSeq Size 1840
RefSeq ORF 132
Locus ID 85316
Gene Summary Unknown. Candidate gene encoding tumor antigens. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.