BAGE5 (NM_182484) Human Untagged Clone
CAT#: SC309311
BAGE5 (untagged)-Human B melanoma antigen family, member 5 (BAGE5)
"NM_182484" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BAGE5 |
Synonyms | CT2.5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_182484 edited
ATGGTGGTGGCAACAGAGATGGCAGCGCAGCTGGAGTGTTAGGAGGGCGGCCTGAGCGGT AGGAGTGGGGCTGGAGCAGTAAGATGGCGGCCGGAGCGGTTTTTCTGGCATTGTCTGCCC AGCTGCTCCAAGCCAGGCTGATGAAGGAGGAGTCCCCTGTGGTGAGCTGGAGGTTGGAGC CTGAAGACGGCACAGCTCTGTGCTTCATCTTCTGAGGTTGTGGCAGCCACGGTGATGGAG ACGGCAGCTCAACAGGAGCAATAGGAGGAGATGGAGTTTCACTGTGTCAGCCAGGGATAT ACCAAA |
Restriction Sites | Please inquire |
ACCN | NM_182484 |
ORF Size | 132 bp |
Insert Size | 300 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_182484.1. |
Reference Data | |
RefSeq | NM_182484.1, NP_872290.1 |
RefSeq Size | 1840 |
RefSeq ORF | 132 |
Locus ID | 85316 |
Gene Summary | Unknown. Candidate gene encoding tumor antigens. [UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224286 | BAGE5 (Myc-DDK-tagged)-Human B melanoma antigen family, member 5 (BAGE5) |
USD 420.00 |
|
RG224286 | BAGE5 (GFP-tagged) - Human B melanoma antigen family, member 5 (BAGE5) |
USD 460.00 |
|
RC224286L3 | Lenti ORF clone of Human B melanoma antigen family, member 5 (BAGE5), Myc-DDK-tagged |
USD 620.00 |
|
RC224286L4 | Lenti ORF clone of Human B melanoma antigen family, member 5 (BAGE5), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review