BAGE4 (NM_181704) Human Untagged Clone

CAT#: SC309312

BAGE4 (untagged)-Human B melanoma antigen family, member 4 (BAGE4)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BAGE4
• Synonyms: CT2.4; MLL3P
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_181704 edited
  ATGGTGGTGGCAACAGAGATGGCAGCGCAGCTGGAGTGTTAGGAGGGCGGCCTGAGCGGT
  AGGAGTGGGGCTGGAGCAGTAAGATGGCGGCCGGAGCGGTTTTTCTGGCATTGTCTGCCC
  AGCTGCTCCAAGCCAGGCTGATGAAGGAGGAGTCCCCTGTGGTGAGCTGGTGGTTGGAGC
  CTGAAGACGGCACAGCTCTGTGATTCATCTTCTGAGGTTGTGGCAGCCACGGTGATGGAG
  ACGGCAGCTCAACAGGAGCAATAGGAGGAGATGGAGGTTCACTGTGTCAGCCAGGGATAT
  ACCAAA
  
• Restriction Sites: Please inquire
• ACCN: NM_181704
• ORF Size: 120 bp
• Insert Size: 300
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_181704.1. This SNP doesn't change amino acid.

Reference Data

• RefSeq: NM_181704.1, NP_859055.1
• RefSeq Size: 1840
• RefSeq ORF: 120
• Locus ID: 85317
• Protein Families: Druggable Genome
• Gene Summary: Unknown. Candidate gene encoding tumor antigens. [UniProtKB/Swiss-Prot Function]