Nociceptin receptor (OPRL1) (NM_182647) Human Untagged Clone

CAT#: SC309317

OPRL1 (untagged)-Human opiate receptor-like 1 (OPRL1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OPRL1
• Synonyms: KOR-3; NOCIR; NOP; NOPr; OOR; ORL1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_182647, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCCCCTCTTCCCCGCGCCGTTCTGGGAGGTTATCTACGGCAGCCACCTTCAGGGCAACCTGTCCC
  TCCTGAGCCCCAACCACAGTCTGCTGCCCCCGCATCTGCTGCTCAATGCCAGCCACGGCGCCTTCCTGCC
  CCTCGGGCTCAAGGTCACCATCGTGGGGCTCTACCTGGCCGTGTGTGTCGGAGGGCTCCTGGGGAACTGC
  CTTGTCATGTACGTCATCCTCAGGCACACCAAAATGAAGACAGCCACCAATATTTACATCTTTAACCTGG
  CCCTGGCCGACACTCTGGTCCTGCTGACGCTGCCCTTCCAGGGCACGGACATCCTCCTGGGCTTCTGGCC
  GTTTGGGAATGCGCTGTGCAAGACAGTCATTGCCATTGACTACTACAACATGTTCACCAGCACCTTCACC
  CTAACTGCCATGAGTGTGGATCGCTATGTAGCCATCTGCCACCCCATCCGTGCCCTCGACGTCCGCACGT
  CCAGCAAAGCCCAGGCTGTCAATGTGGCCATCTGGGCCCTGGCCTCTGTTGTCGGTGTTCCCGTTGCCAT
  CATGGGCTCGGCACAGGTCGAGGATGAAGAGATCGAGTGCCTGGTGGAGATCCCTACCCCTCAGGATTAC
  TGGGGCCCGGTGTTTGCCATCTGCATCTTCCTCTTCTCCTTCATCGTCCCCGTGCTCGTCATCTCTGTCT
  GCTACAGCCTCATGATCCGGCGGCTCCGTGGAGTCCGCCTGCTCTCGGGCTCCCGAGAGAAGGACCGGAA
  CCTGCGGCGCATCACTCGGCTGGTGCTGGTGGTAGTGGCTGTGTTCGTGGGCTGCTGGACGCCTGTCCAG
  GTCTTCGTGCTGGCCCAAGGGCTGGGGGTTCAGCCGAGCAGCGAGACTGCCGTGGCCATTCTGCGCTTCT
  GCACGGCCCTGGGCTACGTCAACAGCTGCCTCAACCCCATCCTCTACGCCTTCCTGGATGAGAACTTCAA
  GGCCTGCTTCCGCAAGTTCTGCTGTGCATCTGCCCTGCGCCGGGACGTGCAGGTGTCTGACCGCGTGCGC
  AGCATTGCCAAGGACGTGGCCCTGGCCTGCAAGACCTCTGAGACGGTACCGCGGCCCGCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_182647
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_182647.3, NP_872588.1
• RefSeq Size: 3427 bp
• RefSeq ORF: 1113 bp
• Locus ID: 4987
• Cytogenetics: 20q13.33
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Neuroactive ligand-receptor interaction
• Gene Summary: 'The protein encoded by this gene is a member of the 7 transmembrane-spanning G protein-coupled receptor family, and functions as a receptor for the endogenous, opioid-related neuropeptide, nociceptin/orphanin FQ. This receptor-ligand system modulates a variety of biological functions and neurobehavior, including stress responses and anxiety behavior, learning and memory, locomotor activity, and inflammatory and immune responses. A promoter region between this gene and the 5'-adjacent RGS19 (regulator of G-protein signaling 19) gene on the opposite strand functions bi-directionally as a core-promoter for both genes, suggesting co-operative transcriptional regulation of these two functionally related genes. Alternatively spliced transcript variants have been described for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2017]'
  Transcript Variant: This variant (1) represents the longest transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon, while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UAG termination codon. This RefSeq represents the shorter isoform (1). Variants 1, 2, and 3 encode the same isoform (1).