Ephrin A4 (EFNA4) (NM_182690) Human Untagged Clone
CAT#: SC309495
EFNA4 (untagged)-Human ephrin-A4 (EFNA4), transcript variant 3
"NM_182690" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EFNA4 |
Synonyms | EFL4; EPLG4; LERK4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_182690, the custom clone sequence may differ by one or more nucleotides
ATGCGGCTGCTGCCCCTGCTGCGGACTGTCCTCTGGGCCGCGTTCCTCGGCTCCCCTCTGCGCGGGGGCT CCAGCCTCCGCCACGTAGTCTACTGGAACTCCAGTAACCCCAGGTTGCTTCGAGGAGACGCCGTGGTGGA GCTGGGCCTCAACGATTACCTAGACATTGTCTGCCCCCACTACGAAGGCCCAGGGCCCCCTGAGGGCCCC GAGACGTTTGCTTTGTACATGGTGGACTGGCCAGGCTATGAGTCCTGCCAGGCAGAGGGCCCCCGGGCCT ACAAGCGCTGGGTGTGCTCCCTGCCCTTTGGCCATGTTCAATTCTCAGAGAAGATTCAGCGCTTCACACC CTTCTCCCTCGGCTTTGAGTTCTTACCTGGAGAGACTTACTACTACATCTCGGTGCCCACTCCAGAGAGT TCTGGCCAGTGCTTGAGGCTCCAGGTGTCTGTCTGCTGCAAGGAGAGGAACCTTCCCTCTCATCCCAAGG AGCCAGAGTCCTCCCAAGATCCCCTGGAGGAGGAGGGATCCCTGCTGCCTGCACTGGGGGTGCCAATTCA GACCGACAAGATGGAGCATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_182690 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_182690.2, NP_872632.2 |
RefSeq Size | 1111 bp |
RefSeq ORF | 582 bp |
Locus ID | 1945 |
Cytogenetics | 1q21.3 |
Protein Families | Secreted Protein |
Protein Pathways | Axon guidance |
Gene Summary | 'This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNA class ephrin. Three transcript variants that encode distinct proteins have been identified. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (3), also known as ephrin-A4 (s), uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a downstream translation termination. It encodes isoform c which has a distinct and slightly shorter C-terminus compared to isoform a. Isoform c lacks a characteristic transmembrane domain and the GPI-signal sequence contained in isoform a. Isoform c is a secreted molecule. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220109 | EFNA4 (Myc-DDK-tagged)-Human ephrin-A4 (EFNA4), transcript variant 3 |
USD 420.00 |
|
RG220109 | EFNA4 (GFP-tagged) - Human ephrin-A4 (EFNA4), transcript variant 3 |
USD 460.00 |
|
RC220109L1 | Lenti ORF clone of Human ephrin-A4 (EFNA4), transcript variant 3, Myc-DDK-tagged |
USD 768.00 |
|
RC220109L2 | Lenti ORF clone of Human ephrin-A4 (EFNA4), transcript variant 3, mGFP tagged |
USD 620.00 |
|
RC220109L3 | Lenti ORF clone of Human ephrin-A4 (EFNA4), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC220109L4 | Lenti ORF clone of Human ephrin-A4 (EFNA4), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review