MAL (NM_022439) Human Untagged Clone

CAT#: SC309513

MAL (untagged)-Human mal, T-cell differentiation protein (MAL), transcript variant c

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MAL
• Synonyms: MVP17; VIP17
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_022439, the custom clone sequence may differ by one or more nucleotides
  ATGGCCCCCGCAGCGGCGACGGGGGGCAGCACCCTGCCCAGTGGCTTCTCGGTCTTCACC
  ACCTTGCCCGACTTGCTCTTCATCTTTGAGTTTGACGCAGCCTACCACTGCACCGCTGCC
  CTCTTTTACCTCAGCGCCTCAGTCCTGGAGGCCCTGGCCACCATCACGATGCAAGACGGC
  TTCACCTACAGGCACTACCATGAAAACATTGCTGCCGTGGTGTTCTCCTACATAGCCACT
  CTGCTCTACGTGGTCCATGCGGTGTTCTCTTTAATCAGATGGAAGTCTTCATAA
  
• Restriction Sites: Please inquire
• ACCN: NM_022439
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_022439.1, NP_071884.1
• RefSeq Size: 888 bp
• RefSeq ORF: 294 bp
• Locus ID: 4118
• Cytogenetics: 2q11.1
• Protein Families: Transmembrane
• Gene Summary: 'The protein encoded by this gene is a highly hydrophobic integral membrane protein belonging to the MAL family of proteolipids. The protein has been localized to the endoplasmic reticulum of T-cells and is a candidate linker protein in T-cell signal transduction. In addition, this proteolipid is localized in compact myelin of cells in the nervous system and has been implicated in myelin biogenesis and/or function. The protein plays a role in the formation, stabilization and maintenance of glycosphingolipid-enriched membrane microdomains. Down-regulation of this gene has been associated with a variety of human epithelial malignancies. Alternative splicing produces four transcript variants which vary from each other by the presence or absence of alternatively spliced exons 2 and 3. [provided by RefSeq, May 2012]'
  Transcript Variant: This variant (c) is missing alternatively spliced exon 2 but includes exon 3, resulting in isoform c which is shorter than the predominant isoform (a).