OGG1 (NM_016829) Human Untagged Clone

CAT#: SC309530

OGG1 (untagged)-Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 2e


  "NM_016829" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "OGG1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OGG1
Synonyms HMMH; HOGG1; MUTM; OGH1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_016829, the custom clone sequence may differ by one or more nucleotides


ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCTGCCCTGTGGG
CCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCTTCTGGACAATCTTTCCGGTG
GAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCGGATCAAGTATGGACACTGACTCAGACTGAG
GAGCAGCTCCACTGCACTGTGTACCGAGGAGACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGG
AGGCCGTGCGCAAGTACTTCCAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGA
CTCCCACTTCCAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAGCGGCTGTGCC
AGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGCTTCCCCAGCCTGCAGGCCCT
GGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGCCTGGGCTATCGTGCCCGTTACGTGAGTGCC
AGTGCCCGAGCCATCCTGGAAGAACAGGGCGGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATG
AGGAGGCCCACAAGGCCCTCTGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGAT
GGCCCTAGACAAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGAAACTTTTTCC
GGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGCTGGATCAGATGCCTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_016829
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016829.2, NP_058438.1
RefSeq Size 2211 bp
RefSeq ORF 969 bp
Locus ID 4968
Cytogenetics 3p25.3
Protein Families Druggable Genome
Protein Pathways Base excision repair
Gene Summary 'This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008]'
Transcript Variant: Transcript variant 2e contains an alternate exon 8 and a 53 bp insertion between exons 6 and 8, as compared to the predominant transcript variant 1a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.