PAX3 (NM_181458) Human Untagged Clone

CAT#: SC309537

PAX3 (untagged)-Human paired box 3 (PAX3), transcript variant PAX3D


  "NM_181458" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PAX3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PAX3
Synonyms CDHS; HUP2; WS1; WS3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_181458, the custom clone sequence may differ by one or more nucleotides


ATGACCACGCTGGCCGGCGCTGTGCCCAGGATGATGCGGCCGGGCCCGGGGCAGAACTACCCGCGTAGCG
GGTTCCCGCTGGAAGTGTCCACTCCCCTCGGCCAGGGCCGCGTCAACCAGCTCGGCGGTGTTTTTATCAA
CGGCAGGCCGCTGCCCAACCACATCCGCCACAAGATCGTGGAGATGGCCCACCACGGCATCCGGCCCTGC
GTCATCTCGCGCCAGCTGCGCGTGTCCCACGGCTGCGTCTCCAAGATCCTGTGCAGGTACCAGGAGACTG
GCTCCATACGTCCTGGTGCCATCGGCGGCAGCAAGCCCAAGCAGGTGACAACGCCTGACGTGGAGAAGAA
AATTGAGGAATACAAAAGAGAGAACCCGGGCATGTTCAGCTGGGAAATCCGAGACAAATTACTCAAGGAC
GCGGTCTGTGATCGAAACACCGTGCCGTCAGTGAGTTCCATCAGCCGCATCCTGAGAAGTAAATTCGGGA
AAGGTGAAGAGGAGGAGGCCGACTTGGAGAGGAAGGAGGCAGAGGAAAGCGAGAAGAAGGCCAAACACAG
CATCGACGGCATCCTGAGCGAGCGAGCCTCAGCACCCCAATCAGATGAAGGCTCTGATATTGACTCTGAA
CCAGATTTACCACTAAAGAGGAAACAGCGCAGAAGCCGAACCACCTTCACAGCAGAACAGCTGGAGGAAC
TGGAGCGTGCTTTTGAGAGAACTCATTACCCTGACATTTATACTAGGGAGGAACTGGCCCAGAGGGCGAA
GCTCACCGAGGCCCGAGTACAGGTCTGGTTTAGCAACCGCCGTGCAAGATGGAGGAAGCAAGCTGGGGCC
AATCAACTGATGGCTTTCAACCATCTCATTCCCGGGGGGTTCCCTCCCACTGCCATGCCGACCTTGCCAA
CGTACCAGCTGTCGGAGACCTCTTACCAGCCCACATCTATTCCACAAGCTGTGTCAGATCCCAGCAGCAC
CGTTCACAGACCTCAACCGCTTCCTCCAAGCACTGTACACCAAAGCACGATTCCTTCCAACCCAGACAGC
AGCTCTGCCTACTGCCTCCCCAGCACCAGGCATGGATTTTCCAGCTATACAGACAGCTTTGTGCCTCCGT
CGGGGCCCTCCAACCCCATGAACCCCACCATTGGCAATGGCCTCTCACCTCAGGTAATGGGACTCCTGAC
CAACCACGGTGGGGTACCTCATCAGCCCCAGACTGATTACGCGCTCTCCCCTCTCACCGGGGGTCTGGAA
CCTACCACCACGGTGTCGGCCAGCTGCAGTCAGAGACTAGACCATATGAAGAGCTTGGACAGTCTGCCAA
CATCTCAGTCCTACTGTCCACCCACCTATAGCACCACAGGCTACAGTATGGACCCTGTCACAGGCTACCA
ATATGGGCAGTATGGACAAAGTGCCTTTCATTATCTCAAGCCAGATATCGCGTAA


Restriction Sites SgfI-MluI     
ACCN NM_181458
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181458.3, NP_852123.1
RefSeq Size 3359 bp
RefSeq ORF 1455 bp
Locus ID 5077
Cytogenetics 2q36.1
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Transcription Factors
Gene Summary 'This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (PAX3D) differs in the 3' UTR, and contains an alternate splice pattern in the 3' coding region, compared to variant PAX3. The resulting protein (isoform PAX3d) is longer and has a distinct C-terminus, compared to isoform PAX3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.