RFC4 (NM_181573) Human Untagged Clone

CAT#: SC309555

RFC4 (untagged)-Human replication factor C (activator 1) 4, 37kDa (RFC4), transcript variant 2


  "NM_181573" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RFC4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RFC4
Synonyms A1; RFC37
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_181573, the custom clone sequence may differ by one or more nucleotides


ATGCAAGCATTTCTTAAAGGTACATCCATCAGTACTAAACCCCCGCTGACCAAGGATCGAGGAGTAGCTG
CCAGTGCGGGAAGTAGCGGAGAGAACAAGAAAGCCAAACCCGTTCCCTGGGTGGAAAAATATCGCCCAAA
ATGTGTGGATGAAGTTGCTTTCCAGGAAGAAGTGGTTGCAGTGCTGAAAAAATCTTTAGAAGGAGCAGAT
CTTCCTAATCTCTTGTTTTACGGACCACCTGGAACTGGAAAAACATCCACTATTTTGGCAGCAGCTAGAG
AACTCTTTGGGCCTGAACTTTTCCGATTAAGAGTTCTTGAGTTAAATGCATCTGATGAACGTGGAATACA
AGTAGTTCGAGAGAAAGTGAAAAATTTTGCTCAATTAACTGTGTCAGGAAGTCGCTCAGATGGGAAGCCG
TGTCCGCCTTTTAAGATTGTGATTCTGGATGAAGCAGATTCTATGACCTCAGCTGCTCAGGCAGCTTTAA
GACGTACCATGGAGAAGGAGTCGAAAACCACCCGATTCTGTCTTATCTGTAACTATGTCAGTCGAATAAT
TGAACCCCTGACCTCTAGATGTTCAAAATTCCGCTTCAAGCCTCTGTCAGATAAAATTCAACAGCAGCGA
TTACTAGACATTGCCAAGAAGGAAAATGTCAAAATTAGTGATGAGGGAATAGCTTATCTTGTTAAAGTGT
CAGAAGGAGACTTAAGAAAAGCCATTACATTTCTTCAAAGCGCTACTCGATTAACAGGTGGAAAGGAGAT
CACAGAGAAAGTGATTACAGACATTGCCGGGGTAATACCAGCTGAGAAAATTGATGGAGTATTTGCTGCC
TGTCAGAGTGGCTCTTTTGACAAACTAGAAGCTGTGGTCAAGGATTTAATAGATGAGGGTCATGCAGCAA
CTCAGCTCGTCAATCAACTCCATGATGTGGTTGTAGAAAATAACTTATCTGATAAACAGAAGTCTATTAT
CACAGAAAAACTTGCCGAAGTTGACAAATGCCTAGCAGATGGTGCTGATGAACATTTGCAACTCATCAGC
CTTTGTGCAACTGTGATGCAGCAGTTATCTCAGAATTGTTAA


Restriction Sites SgfI-MluI     
ACCN NM_181573
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181573.2, NP_853551.1
RefSeq Size 1486 bp
RefSeq ORF 1092 bp
Locus ID 5984
Cytogenetics 3q27.3
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways DNA replication, Mismatch repair, Nucleotide excision repair
Gene Summary 'The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kD. This gene encodes the 37 kD subunit. This subunit forms a core complex with the 36 and 40 kDa subunits. The core complex possesses DNA-dependent ATPase activity, which was found to be stimulated by PCNA in an in vitro system. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.