delta Sarcoglycan (SGCD) (NM_172244) Human Untagged Clone

CAT#: SC309561

SGCD (untagged)-Human sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) (SGCD), transcript variant 2


  "NM_172244" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SGCD"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SGCD
Synonyms 35DAG; CMD1L; DAGD; LGMDR6; SG-delta; SGCDP; SGD
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_172244 edited
GACAAGAGAGAGACATTACTGCCGGGAGTGTTGAGTGAAGGGACCAGGTGGAGATGATGC
CTCAGGAGCAGTACACTCACCACCGGAGCACCATGCCTGGCTCTGTGGGGCCACAGGTAT
ACAAGGTGGGGATTTATGGCTGGCGGAAACGATGCCTGTATTTCTTTGTCCTGCTCCTCA
TGATTTTAATACTGGTGAACTTGGCCATGACCATCTGGATTCTCAAAGTCATGAACTTCA
CAATTGATGGAATGGGAAACCTGAGGATCACAGAAAAAGGTCTAAAGCTAGAAGGAGACT
CTGAATTCTTACAACCTCTCTACGCCAAAGAAATCCAGTCCCAACCAGGTAATGCCCTGT
ACTTCAAGTCTGCCAGAAATGTTACAGTGAACATTCTCAATGACCAGACTAAAGTGCTAA
CTCAGCTTATAACAGGTCCAAAAGCCGTAGAAGCTTATGGTAAAAAATTTGAGGTAAAAA
CTGTTTCTGGAAAATTGCTCTTCTCTGCAGACAATAATGAAGTGGTAGTAGGAGCTGAAA
GATTACGAGTTTTAGGAGCGGAGGGCACAGTGTTCCCTAAATCTATAGAAACACCTAATG
TCAGGGCAGACCCCTTCAAAGAACTAAGGTTGGAGTCCCCAACCCGGTCTCTAGTGATGG
AGGCCCCAAAAGGAGTGGAAATCAATGCAGAAGCTGGCAATATGGAAGCCACCTGCAGGA
CAGAGCTGAGACTGGAATCCAAAGATGGAGAGGTGAGGGATGAGAAGGACAGAAGTTCAA
AGAGCTACAGCTTCAACAGGCCAACCCTTCCCATAACTGGTTGACCTCGGAGTTGGATCC
TACAGTGTATCAACAAAAGGAGCCAAGCAGGTTTTATTTCTGAAACAATTAATTGAGCAG
CATGATTATAAGCCAAACCCACAATCCATCAAAGTGATGATTTCTTATTTGTAAAATGCA
GAGATAATGGCATGTATTCCAAGTACAGAATTATATGACCATGAAAATGAATGCTATTTT
CAAATTCTCTCTTGTCACCTTAAAATAAGATTTTGTTAGCCAACATAATTAAGCTGTATA
TATTATACACATCTGGCTCAAGATGAACTTAAAAAAAAAAAAAAAAAA
Restriction Sites NotI-NotI     
ACCN NM_172244
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_172244.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_172244.2, NP_758447.1
RefSeq Size 1576 bp
RefSeq ORF 771 bp
Locus ID 6444
Cytogenetics 5q33.2-q33.3
Protein Families Transmembrane
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), Viral myocarditis
Gene Summary 'The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2, also known as SGCD2), contains an alternate 3' terminal exon compared to transcript variant 1. This results in a shorter isoform (2) with a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.