TRAF3 (NM_145726) Human Untagged Clone
CAT#: SC309572
TRAF3 (untagged)-Human TNF receptor-associated factor 3 (TRAF3), transcript variant 2
"NM_145726" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TRAF3 |
Synonyms | CAP-1; CAP1; CD40bp; CRAF1; IIAE5; LAP1; RNF118 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_145726, the custom clone sequence may differ by one or more nucleotides
ATGGAGTCGAGTAAAAAGATGGACTCTCCTGGCGCGCTGCAGACTAACCCGCCGCTAAAGCTGCACACTG ACCGCAGTGCTGGGACGCCAGTTTTTGTCCCTGAACAAGGAGGTTACAAGGAAAAGTTTGTGAAGACCGT GGAGGACAAGTACAAGTGTGAGAAGTGCCACCTGGTGCTGTGCAGCCCGAAGCAGACCGAGTGTGGGCAC CGCTTCTGCGAGAGCTGCATGGCGGCCCTGCTGAGCTCTTCAAGTCCAAAATGTACAGCGTGTCAAGAGA GCATCGTTAAAGATAAGGTGTTTAAGGATAATTGCTGCAAGAGAGAAATTCTGGCTCTTCAGATCTATTG TCGGAATGAAAGCAGAGGTTGTGCAGAGCAGTTAATGCTGGGACATCTGCTGGTGCATTTAAAAAATGAT TGCCATTTTGAAGAACTTCCATGTGTGCGTCCTGACTGCAAAGAAAAGGTCTTGAGGAAAGACCTGCGAG ACCACGTGGAGAAGGCGTGTAAATACCGGGAAGCCACATGCAGCCACTGCAAGAGTCAGGTTCCGATGAT CGCGCTGCAGAAACACGAAGACACCGACTGTCCCTGCGTGGTGGTGTCCTGCCCTCACAAGTGCAGCGTC CAGACTCTCCTGAGGAGCGAGGGGACAAACCAGCAGATCAAGGCCCACGAGGCCAGCTCCGCCGTGCAGC ACGTCAACCTGCTGAAGGAGTGGAGCAACTCGCTCGAAAAGAAGGTTTCCTTGTTGCAGAATGAAAGTGT AGAAAAAAACAAGAGCATACAAAGTTTGCACAATCAGATATGTAGCTTTGAAATTGAAATTGAGAGACAA AAGGAAATGCTTCGAAATAATGAATCCAAAATCCTTCATTTACAGCGAGTGATAGACAGCCAAGCAGAGA AACTGAAGGAGCTTGACAAGGAGATCCGGCCCTTCCGGCAGAACTGGGAGGAAGCAGACAGCATGAAGAG CAGCGTGGAGTCCCTCCAGAACCGCGTGACCGAGCTGGAGAGCGTGGACAAGAGCGCGGGGCAAGTGGCT CGGAACACAGGCCTGCTGGAGTCCCAGCTGAGCCGGCATGACCAGATGCTGAGTGTGCACGACATCCGCC TAGCCGACATGGACCTGCGCTTCCAGGTCCTGGAGACCGCCAGCTACAATGGAGTGCTCATCTGGAAGAT TCGCGACTACAAGCGGCGGAAGCAGGAGGCCGTCATGGGGAAGACCCTGTCCCTTTACAGCCAGCCTTTC TACACTGGTTACTTTGGCTATAAGATGTGTGCCAGGGTCTACCTGAACGGGGACGGGATGGGGAAGGGGA CGCACTTGTCGCTGTTTTTTGTCATCATGCGTGGAGAATATGATGCCCTGCTTCCTTGGCCGTTTAAGCA GAAAGTGACACTCATGCTGATGGATCAGGGGTCCTCTCGACGTCATTTGGGAGATGCATTCAAGCCCGAC CCCAACAGCAGCAGCTTCAAGAAGCCCACTGGAGAGATGAATATCGCCTCTGGCTGCCCAGTCTTTGTGG CCCAAACTGTTCTAGAAAATGGGACATATATTAAAGATGATACAATTTTTATTAAAGTCATAGTGGATAC TTCGGATCTGCCCGATCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_145726 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_145726.2, NP_663778.1 |
RefSeq Size | 7718 bp |
RefSeq ORF | 1632 bp |
Locus ID | 7187 |
Cytogenetics | 14q32.32 |
Protein Families | Druggable Genome |
Protein Pathways | Pathways in cancer, RIG-I-like receptor signaling pathway, Small cell lung cancer, Toll-like receptor signaling pathway |
Gene Summary | 'The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. The protein also plays a role in the regulation of antiviral response. Mutations in this are associated with Encephalopathy, acute, infection-induced, herpes-specific 5. [provided by RefSeq, Jul 2020]' Transcript Variant: This variant (2) lacks an in-frame coding segment compared to variant 1. The resulting isoform (2) lacks an internal region compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212854 | TRAF3 (Myc-DDK-tagged)-Human TNF receptor-associated factor 3 (TRAF3), transcript variant 2 |
USD 480.00 |
|
RG212854 | TRAF3 (GFP-tagged) - Human TNF receptor-associated factor 3 (TRAF3), transcript variant 2 |
USD 530.00 |
|
RC212854L3 | Lenti-ORF clone of TRAF3 (Myc-DDK-tagged)-Human TNF receptor-associated factor 3 (TRAF3), transcript variant 2 |
USD 680.00 |
|
RC212854L4 | Lenti-ORF clone of TRAF3 (mGFP-tagged)-Human TNF receptor-associated factor 3 (TRAF3), transcript variant 2 |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review