CDK10 (NM_052987) Human Untagged Clone

CAT#: SC309589

CDK10 (untagged)-Human cyclin-dependent kinase 10 (CDK10), transcript variant b


  "NM_052987" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CDK10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDK10
Synonyms ALSAS; PISSLRE
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_052987, the custom clone sequence may differ by one or more nucleotides
ATGGACAAGGAGAAGGATGGCATCCCCATCAGCAGCTTGCGGGAGATCACGCTGCTGCTC
CGCCTGCGTCATCCGAACATCGTGGAGCTGAAGGAGGTGGTTGTGGGGAACCACCTGGAG
AGCATCTTCCTGGTGATGGGTTACTGTGAGCAGGACCTGGCCAGCCTCCTGGAGAATATG
CCAACACCCTTCTCGGAGGCTCAGGTCAAGTGCATCGTGCTGCAGGTGCTCCGGGGCCTC
CAGTATCTGCACAGGAACTTCATTATCCACAGGGACCTGAAGGTTTCCAACTTGCTCATG
ACCGACAAGGGTTGTGTGAAGACAGCGGATTTCGGCCTGGCCCGGGCCTATGGTGTCCCA
GTAAAGCCAATGACCCCCAAGGTGGTCACTCTCTGGTACCGAGCCCCTGAACTGCTGTTG
GGAACCACCACGCAGACCACCAGCATCGACATGTGGGCTGTGGGCTGCATACTGGCCGAG
CTGCTGGCGCACAGGCCTCTTCTCCCCGGCACTTCCGAGATCCACCAGATCGACTTGATC
GTGCAGCTGCTGGGCACGCCCAGTGAGAACATCTGGCCGGGCTTTTCCAAGCTGCCACTG
GTCGGCCAGTACAGCCTCCGGAAGCAGCCCTACAACAACCTGAAGCACAAGTTCCCATGG
CTGTCGGAGGCCGGGCTGCGCCTGCTGCACTTCCTGTTCATGTACGACCCTAAGAAAAGG
GCGACGGCCGGGGACTGCCTGGAGAGCTCCTATTTCAAGGAGAAGCCCCTACGTCTTCCG
ATCAGTGGTGTCTGTGAAGGGTGCCGCGAGCCAGGCTGA
Restriction Sites Please inquire     
ACCN NM_052987
ORF Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_052987.2, NP_443713.1
RefSeq Size 1633
RefSeq ORF 945
Locus ID 8558
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Gene Summary The protein encoded by this gene belongs to the CDK subfamily of the Ser/Thr protein kinase family. The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. This kinase has been shown to play a role in cellular proliferation and its function is limited to cell cycle G2-M phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Transcript Variant: This variant (b) uses an alternate donor splice site at the first exon resulting in translation from a downstream start codon, and uses an alternate acceptor splice site at the last exon, compared to variant a. The resulting isoform (b) has a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.