CDK10 (NM_052987) Human Untagged Clone

CAT#: SC309589

CDK10 (untagged)-Human cyclin-dependent kinase 10 (CDK10), transcript variant b

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDK10
• Synonyms: ALSAS; PISSLRE
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_052987, the custom clone sequence may differ by one or more nucleotides
  ATGGACAAGGAGAAGGATGGCATCCCCATCAGCAGCTTGCGGGAGATCACGCTGCTGCTC
  CGCCTGCGTCATCCGAACATCGTGGAGCTGAAGGAGGTGGTTGTGGGGAACCACCTGGAG
  AGCATCTTCCTGGTGATGGGTTACTGTGAGCAGGACCTGGCCAGCCTCCTGGAGAATATG
  CCAACACCCTTCTCGGAGGCTCAGGTCAAGTGCATCGTGCTGCAGGTGCTCCGGGGCCTC
  CAGTATCTGCACAGGAACTTCATTATCCACAGGGACCTGAAGGTTTCCAACTTGCTCATG
  ACCGACAAGGGTTGTGTGAAGACAGCGGATTTCGGCCTGGCCCGGGCCTATGGTGTCCCA
  GTAAAGCCAATGACCCCCAAGGTGGTCACTCTCTGGTACCGAGCCCCTGAACTGCTGTTG
  GGAACCACCACGCAGACCACCAGCATCGACATGTGGGCTGTGGGCTGCATACTGGCCGAG
  CTGCTGGCGCACAGGCCTCTTCTCCCCGGCACTTCCGAGATCCACCAGATCGACTTGATC
  GTGCAGCTGCTGGGCACGCCCAGTGAGAACATCTGGCCGGGCTTTTCCAAGCTGCCACTG
  GTCGGCCAGTACAGCCTCCGGAAGCAGCCCTACAACAACCTGAAGCACAAGTTCCCATGG
  CTGTCGGAGGCCGGGCTGCGCCTGCTGCACTTCCTGTTCATGTACGACCCTAAGAAAAGG
  GCGACGGCCGGGGACTGCCTGGAGAGCTCCTATTTCAAGGAGAAGCCCCTACGTCTTCCG
  ATCAGTGGTGTCTGTGAAGGGTGCCGCGAGCCAGGCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_052987
• ORF Size: 945 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_052987.2, NP_443713.1
• RefSeq Size: 1633
• RefSeq ORF: 945
• Locus ID: 8558
• Domains: pkinase, TyrKc, S_TKc
• Protein Families: Druggable Genome, Protein Kinase
• Gene Summary: The protein encoded by this gene belongs to the CDK subfamily of the Ser/Thr protein kinase family. The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. This kinase has been shown to play a role in cellular proliferation and its function is limited to cell cycle G2-M phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
  Transcript Variant: This variant (b) uses an alternate donor splice site at the first exon resulting in translation from a downstream start codon, and uses an alternate acceptor splice site at the last exon, compared to variant a. The resulting isoform (b) has a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform a.