CABP (CABP1) (NM_031205) Human Untagged Clone

CAT#: SC309599

CABP1 (untagged)-Human calcium binding protein 1 (CABP1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CABP1
• Synonyms: CALBRAIN; HCALB_BR
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_031205, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCAACTGTGTCAAGTATCCACTGAGAAATCTCTCAAGGAAGATGTGCCAGGAGGAACAGACCAGCT
  ACATGGTGGTGCAGACGAGCGAGGAGGGGCTGGCGGCTGACGCCGAGCTCCCGGGACCGCTCCTGATGCT
  GGCCCAGAACTGCGCAGTCATGCACAACCTGCTGGGCCCTGCCTGCATTTTCCTGCGCAAGGGCTTCGCT
  GAGAACAGGCAGCCTGATAGATCACTGCGACCAGAGGAAATTGAAGAGCTCCGAGAGGCCTTCAGAGAAT
  TCGACAAGGACAAGGATGGCTACATCAACTGCCGGGATCTGGGCAACTGCATGCGCACCATGGGCTACAT
  GCCCACCGAGATGGAGCTCATCGAACTGTCCCAGCAGATCAACATGAACCTGGGTGGCCATGTAGATTTT
  GATGACTTCGTGGAGCTAATGGGGCCTAAACTCCTGGCAGAGACAGCAGATATGATTGGTGTAAAGGAAC
  TGCGAGATGCTTTCCGAGAGTTTGACACCAATGGTGATGGGGAAATAAGCACCAGTGAGCTGCGAGAGGC
  TATGAGGAAGCTCCTGGGTCATCAGGTGGGACACCGAGACATAGAGGAAATTATCCGAGATGTGGACCTC
  AATGGGGATGGACGAGTGGACTTTGAAGAGTTTGTCCGGATGATGTCCCGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_031205
• ORF Size: 684 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_031205.3, NP_112482.1
• RefSeq Size: 1262
• RefSeq ORF: 684
• Locus ID: 9478
• Domains: EFh
• Gene Summary: Calcium binding proteins are an important component of calcium mediated cellular signal transduction. This gene encodes a protein that belongs to a subfamily of calcium binding proteins which share similarity to calmodulin. The protein encoded by this gene regulates the gating of voltage-gated calcium ion channels. This protein inhibits calcium-dependent inactivation and supports calcium-dependent facilitation of ion channels containing voltage-dependent L-type calcium channel subunit alpha-1C. This protein also regulates calcium-dependent activity of inositol 1,4,5-triphosphate receptors, P/Q-type voltage-gated calcium channels, and transient receptor potential channel TRPC5. This gene is predominantly expressed in retina and brain. Alternative splicing results in multiple transcript variants encoding disinct isoforms. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (1) has an alternate 5' sequence, as compared to variant 3. The encoded isoform 1 has a distinct and shorter N-terminus, as compared to isoform 3.