CD200R (CD200R1) (NM_138939) Human Untagged Clone

CAT#: SC309709

CD200R1 (untagged)-Human CD200 receptor 1 (CD200R1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD200R1
• Synonyms: CD200R; HCRTR2; MOX2R; OX2R
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_138939 edited
  GCCACCATGCTCTGCCCTTGGAGAACTGCTAACCTAGGGCTACTGTTGATTTTGACTATC
  TTCTTAGTGGCCGAAGCGGAGGGTGCTGCTCAACCAAACAACTCATTAATGCTGCAAACT
  AGCAAGGAGAATCATGCTTTAGCTTCAAGCAGTTTATGTATGGATGAAAAACAGATTACA
  CAGAACTACTCGAAAGTACTCGCAGAAGTTAACACTTCATGGCCTGTAAAGATGGCTACA
  AATGCTGTGCTTTGTTGCCCTCCTATCGCATTAAGAAATTTGATCATAATAACATGGGAA
  ATAATCCTGAGAGGCCAGCCTTCCTGCACAAAAGCCTACAAGAAAGAAACAAATGAGACC
  AAGGAAACCAACTGTACTGATGAGAGAATAACCTGGGTCTCCAGACCTGATCAGAATTCG
  GACCTTCAGATTCGTACCGTGGCCATCACTCATGACGGGTATTACAGATGCATAATGGTA
  ACACCTGATGGGAATTTCCATCGTGGATATCACCTCCAAGTGTTAGGTAAGGAGCATCAT
  ATATTGAGGTATTTCACATCACCAGATTTGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_138939
• ORF Size: 567 bp
• Insert Size: 600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_138939.2, NP_620385.1
• RefSeq Size: 1025
• RefSeq ORF: 567
• Locus ID: 131450
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) includes an alternate exon in the coding region, compared to variant 1. This results in a frameshift and early stop codon, as well as loss of an immunoglobulin and transmembrane domain in the protein (isoform b), compared to isoform a.