Acrosin (ACR) (NM_001097) Human Untagged Clone
CAT#: SC310411
ACR (untagged)-Human acrosin (ACR)
"NM_001097" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ACR |
Synonyms | acrosin; preproacrosin; proacrosin |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001097, the custom clone sequence may differ by one or more nucleotides
ATGGTTGAGATGCTACCAACTGCCATTCTGCTGGTCTTGGCAGTGTCCGTGGTTGCTAAAGATAACGCCA CGTGTGATGGCCCCTGTGGGTTACGGTTCAGGCAAAACCCACAGGGTGGTGTCCGCATCGTCGGCGGGAA GGCTGCACAGCATGGGGCCTGGCCCTGGATGGTCAGCCTCCAGATCTTCACGTACAACAGCCACAGGTAC CACACATGTGGAGGCAGCTTGCTGAATTCACGATGGGTGCTCACTGCTGCTCACTGCTTCGTCGGCAAAA ATAATGTGCATGACTGGAGACTGGTTTTCGGAGCAAAGGAAATTACATATGGGAACAATAAACCAGTAAA GGCGCCTCTGCAAGAGAGATATGTGGAGAAAATCATCATTCATGAAAAATACAACTCTGCGACAGAGGGA AATGACATTGCCCTCGTGGAGATCACCCCTCCCATTTCGTGTGGGCGCTTCATTGGGCCGGGCTGCCTGC CCCACTTTAAGGCAGGCCTCCCCAGAGGCTCCCAGAGCTGCTGGGTGGCCGGCTGGGGATATATAGAAGA GAAAGCCCCCAGGCCATCATCTATACTGATGGAGGCACGTGTGGATCTCATCGACCTGGACTTGTGTAAC TCGACCCAGTGGTACAATGGGCGCGTTCAGCCAACCAATGTGTGCGCGGGGTATCCTGTAGGCAAGATCG ACACCTGCCAGGGAGACAGCGGCGGGCCTCTCATGTGCAAAGACAGCAAGGAAAGCGCCTATGTGGTCGT GGGAATCACAAGCTGGGGGGTAGGCTGTGCCCGTGCCAAGCGCCCCGGAATCTACACGGCCACCTGGCCC TATCTGAACTGGATCGCCTCCAAGATTGGTTCTAACGCTTTGCGTATGATTCAATCGGCCACCCCTCCAC CTCCCACCACTCGACCGCCCCCGATTCGACCCCCCTTCTCCCACCCTATCTCTGCTCACCTTCCTTGGTA TTTCCAACCGCCCCCTCGACCACTTCCACCCCGACCACCGGCAGCCCAGCCCCGACCCCCACCTTCACCC CCGCCCCCACCCCCACCTCCAGCCTCACCTTTACCCCCACCCCCACCCCCACCCCCACCTACACCCTCAT CTACCACAAAACTTCCCCAAGGACTTTCTTTTGCCAAGCGCCTACAGCAGCTCATAGAGGTCTTGAAGGG GAAGACCTATTCCGACGGAAAGAACCATTATGACATGGAGACCACAGAGCTCCCAGAACTGACCTCGACC TCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001097 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001097.2, NP_001088.2 |
RefSeq Size | 1384 bp |
RefSeq ORF | 1266 bp |
Locus ID | 49 |
Cytogenetics | 22q13.33 |
Protein Families | Druggable Genome, Protease |
Gene Summary | 'Acrosin is the major proteinase present in the acrosome of mature spermatozoa. It is a typical serine proteinase with trypsin-like specificity. It is stored in the acrosome in its precursor form, proacrosin. The active enzyme functions in the lysis of the zona pellucida, thus facilitating penetration of the sperm through the innermost glycoprotein layers of the ovum. The mRNA for proacrosin is synthesized only in the postmeiotic stages of spermatogenesis. In humans proacrosin first appears in the haploid spermatids. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214256 | ACR (Myc-DDK-tagged)-Human acrosin (ACR) |
USD 420.00 |
|
RG214256 | ACR (GFP-tagged) - Human acrosin (ACR) |
USD 460.00 |
|
RC214256L1 | Lenti ORF clone of Human acrosin (ACR), Myc-DDK-tagged |
USD 768.00 |
|
RC214256L2 | Lenti ORF clone of Human acrosin (ACR), mGFP tagged |
USD 620.00 |
|
RC214256L3 | Lenti ORF clone of Human acrosin (ACR), Myc-DDK-tagged |
USD 620.00 |
|
RC214256L4 | Lenti ORF clone of Human acrosin (ACR), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review