SAPK3 (MAPK12) (NM_002969) Human Untagged Clone
CAT#: SC310481
MAPK12 (untagged)-Human mitogen-activated protein kinase 12 (MAPK12)
"NM_002969" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MAPK12 |
Synonyms | ERK-6; ERK3; ERK6; MAPK 12; P38GAMMA; PRKM12; SAPK-3; SAPK3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_002969, the custom clone sequence may differ by one or more nucleotides
ATGAGCTCTCCGCCGCCCGCCCGCAGTGGCTTTTACCGCCAGGAGGTGACCAAGACGGCCTGGGAGGTGC GCGCCGTGTACCGGGACCTGCAGCCCGTGGGCTCGGGCGCCTACGGCGCGGTGTGCTCGGCCGTGGACGG CCGCACCGGCGCTAAGGTGGCCATCAAGAAGCTGTATCGGCCTTTCCAGTCCGAGCTGTTCGCCAAGCGC GCCTACCGCGAGCTGCGCCTGCTCAAGCACATGCGCCACGAGAACGTGATCGGGCTGCTGGACGTATTCA CTCCTGATGAGACCCTGGATGACTTCACGGACTTTTACCTGGTGATGCCGTTCATGGGCACCGACCTGGG CAAGCTCATGAAACATGAGAAGCTAGGCGAGGACCGGATCCAGTTCCTCGTGTACCAGATGCTGAAGGGG CTGAGGTATATCCACGCTGCCGGCATCATCCACAGAGACCTGAAGCCCGGCAACCTGGCTGTGAACGAAG ACTGTGAGCTGAAGATCCTGGACTTCGGCCTGGCCAGGCAGGCAGACAGTGAGATGACTGGGTACGTGGT GACCCGGTGGTACCGGGCTCCCGAGGTCATCTTGAATTGGATGCGCTACACGCAGACGGTGGACATCTGG TCTGTGGGCTGCATCATGGCGGAGATGATCACAGGCAAGACGCTGTTCAAGGGCAGCGACCACCTGGACC AGCTGAAGGAGATCATGAAGGTGACGGGGACGCCTCCGGCTGAGTTTGTGCAGCGGCTGCAGAGCGATGA GGCCAAGAACTACATGAAGGGCCTCCCCGAATTGGAGAAGAAGGATTTTGCCTCTATCCTGACCAATGCA AGCCCTCTGGCTGTGAACCTCCTGGAGAAGATGCTGGTGCTGGACGCGGAGCAGCGGGTGACGGCAGGCG AGGCGCTGGCCCATCCCTACTTCGAGTCCCTGCACGACACGGAAGATGAGCCCCAGGTCCAGAAGTATGA TGACTCCTTTGACGACGTTGACCGCACACTGGATGAATGGAAGCGTGTTACTTACAAAGAGGTGCTCAGC TTCAAGCCTCCCCGGCAGCTGGGGGCCAGGGTCTCCAAGGAGACGCCTCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_002969 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002969.4, NP_002960.2 |
RefSeq Size | 1877 bp |
RefSeq ORF | 1104 bp |
Locus ID | 6300 |
Cytogenetics | 22q13.33 |
Domains | pkinase, TyrKc, S_TKc |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Amyotrophic lateral sclerosis (ALS), Epithelial cell signaling in Helicobacter pylori infection, Fc epsilon RI signaling pathway, GnRH signaling pathway, Leukocyte transendothelial migration, MAPK signaling pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, Oocyte meiosis, Progesterone-mediated oocyte maturation, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway, Toll-like receptor signaling pathway, VEGF signaling pathway |
Gene Summary | 'Activation of members of the mitogen-activated protein kinase family is a major mechanism for transduction of extracellular signals. Stress-activated protein kinases are one subclass of MAP kinases. The protein encoded by this gene functions as a signal transducer during differentiation of myoblasts to myotubes. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC323663 | MAPK12 (untagged)-Kinase deficient mutant (K56M) of Human mitogen-activated protein kinase 12 (MAPK12) |
USD 760.00 |
|
RC204857 | MAPK12 (Myc-DDK-tagged)-Human mitogen-activated protein kinase 12 (MAPK12) |
USD 420.00 |
|
RG204857 | MAPK12 (GFP-tagged) - Human mitogen-activated protein kinase 12 (MAPK12) |
USD 460.00 |
|
RC204857L1 | Lenti ORF clone of Human mitogen-activated protein kinase 12 (MAPK12), Myc-DDK-tagged |
USD 768.00 |
|
RC204857L2 | Lenti ORF clone of Human mitogen-activated protein kinase 12 (MAPK12), mGFP tagged |
USD 620.00 |
|
RC204857L3 | Lenti ORF clone of Human mitogen-activated protein kinase 12 (MAPK12), Myc-DDK-tagged |
USD 620.00 |
|
RC204857L4 | Lenti ORF clone of Human mitogen-activated protein kinase 12 (MAPK12), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review